KO | EN

GitLite

Minimalist Open Source Repository Search Engine

gitlite — search

#typescript #ai-agents #developer-tools #codex #claude-code #cli #react #mcp #open-source #deepseek-harness #dsh-plugin #ai

crisprDesign

★ 33 Open GitHub ↗

Comprehensive design of CRISPR gRNAs for nucleases and base editors

// repository documentation

Was this content helpful?

★ 0 (0 ratings)

Introduction to crisprDesign
================

- <a href="#introduction" id="toc-introduction">Introduction</a>
- <a href="#installation" id="toc-installation">Installation</a>
- <a href="#terminology" id="toc-terminology">Terminology</a>
- <a href="#crisprko-design" id="toc-crisprko-design">CRISPRko design</a>
  - <a href="#nuclease-specification"
    id="toc-nuclease-specification">Nuclease specification</a>
  - <a href="#target-dna-specification"
    id="toc-target-dna-specification">Target DNA specification</a>
  - <a href="#designing-spacer-sequences"
    id="toc-designing-spacer-sequences">Designing spacer sequences</a>
  - <a href="#sequence-features-characterization"
    id="toc-sequence-features-characterization">Sequence features
    characterization</a>
  - <a href="#off-target-search" id="toc-off-target-search">Off-target
    search</a>
    - <a href="#iterative-spacer-alignments"
      id="toc-iterative-spacer-alignments">Iterative spacer alignments</a>
    - <a href="#faster-alignment-by-removing-repeat-elements"
      id="toc-faster-alignment-by-removing-repeat-elements">Faster alignment
      by removing repeat elements</a>
  - <a href="#off-target-scoring" id="toc-off-target-scoring">Off-target
    scoring</a>
  - <a href="#on-target-scoring" id="toc-on-target-scoring">On-target
    scoring</a>
  - <a href="#restriction-enzymes" id="toc-restriction-enzymes">Restriction
    enzymes</a>
  - <a href="#gene-annotation" id="toc-gene-annotation">Gene annotation</a>
  - <a href="#tss-annotation" id="toc-tss-annotation">TSS annotation</a>
  - <a href="#snp-information" id="toc-snp-information">SNP information</a>
  - <a href="#filtering-and-ranking-grnas"
    id="toc-filtering-and-ranking-grnas">Filtering and ranking gRNAs</a>
- <a href="#crispracrispri-design"
  id="toc-crispracrispri-design">CRISPRa/CRISPRi design</a>
- <a href="#crispr-base-editing-with-be4max"
  id="toc-crispr-base-editing-with-be4max">CRISPR base editing with
  BE4max</a>
- <a href="#crispr-knockdown-with-cas13d"
  id="toc-crispr-knockdown-with-cas13d">CRISPR knockdown with Cas13d</a>
- <a href="#design-for-optical-pooled-screening-ops"
  id="toc-design-for-optical-pooled-screening-ops">Design for optical
  pooled screening (OPS)</a>
- <a href="#design-of-grna-pairs-with-the--object"
  id="toc-design-of-grna-pairs-with-the--object">Design of gRNA pairs with
  the object</a>
- <a href="#miscellaneous-design-use-cases"
  id="toc-miscellaneous-design-use-cases">Miscellaneous design use
  cases</a>
  - <a href="#design-with-custom-sequences"
    id="toc-design-with-custom-sequences">Design with custom sequences</a>
  - <a href="#off-target-search-in-custom-sequences"
    id="toc-off-target-search-in-custom-sequences">Off-target search in
    custom sequences</a>
- <a href="#session-info" id="toc-session-info">Session Info</a>
- <a href="#references" id="toc-references">References</a>

Authors: Jean-Philippe Fortin, Aaron Lun, Luke Hoberecht

Date: July 1, 2022

# Introduction

`crisprDesign` is the core package of the
[crisprVerse](https://github.com/crisprVerse) ecosystem, and plays the
role of a one-stop shop for designing and annotating CRISPR guide RNA
(gRNA) sequences. This includes the characterization of on-targets and
off-targets using different aligners, on- and off-target scoring, gene
context annotation, SNP annotation, sequence feature characterization,
repeat annotation, and many more.  
The software was developed to be as applicable and generalizable as
possible.

It currently support five types of CRISPR modalities (modes of
perturbations): CRISPR knockout (CRISPRko), CRISPR activation (CRISPRa),
CRISPR interference (CRISPRi), CRISPR base editing (CRISPRbe), and
CRISPR knockdown (CRISPRkd) (see Kampmann (2018) for a review of CRISPR
modalities).

It utilizes the `crisprBase` package to enable gRNA design for any
CRISPR nuclease and base editor via the `CrisprNuclease` and
`BaseEditor` classes, respectively. Nucleases that are commonly used in
the field are provided, including DNA-targeting nucleases (e.g. SpCas9,
AsCas12a) and RNA-targeting nucleases (e.g. CasRx (RfxCas13d)).

`crisprDesign` is fully developed to work with the genome of any
organism, and can also be used to design gRNAs targeting custom DNA
sequences.

Finally, more specialized gRNA design functionalities are also
available, including design for optical pooled screening (OPS), paired
gRNA design, and gRNA filtering and ranking functionalities.

This vignette is meant to be an overview of the main features included
in the package, using toy examples for the sake of time (the vignette
has to compile within a few minutes, as required by Bioconductor). For
detailed and comprehensive tutorials, please visit our [crisprVerse
tutorials page](https://github.com/crisprVerse/Tutorials).

# Installation

`crisprDesign` can be installed from from the Bioconductor devel branch
using the following commands in a fresh R session:

``` r
if (!require("BiocManager", quietly = TRUE))
    install.packages("BiocManager")

BiocManager::install(version="devel")
BiocManager::install("crisprDesign")
```

Users interested in contributing to `crisprDesign` might want to look at
the following CRISPR-related package dependencies:

- [crisprBase](https://github.com/crisprVerse/crisprBase): core CRISPR
  functions and S4 objects
- [crisprBowtie](https://github.com/crisprVerse/crisprBowtie): aligns
  gRNA spacers to genomes using the ungapped aligner `bowtie`
- [crisprBwa](https://github.com/crisprVerse/crisprBWa): aligns gRNA
  spacers to genomes using the ungapped aligner `BWA`
- [crisprScore](https://github.com/crisprVerse/crisprScore): implements
  state-of-the-art on- and off-target scoring algorithms
- [crisprViz](https://github.com/crisprVerse/crisprViz): gRNA
  visualization using genomic tracks

You can contribute to the package by submitting pull requests to our
[GitHub repo](https://github.com/crisprVerse/crisprDesign).

The complete documentation for the package can be found
[here](https://bioconductor.org/packages/devel/bioc/manuals/crisprDesign/man/crisprDesign.pdf).

# Terminology

CRISPR nucleases are examples of RNA-guided endonucleases. They require
two binding components for cleavage. First, the nuclease needs to
recognize a constant nucleotide motif in the target DNA called the
protospacer adjacent motif (PAM) sequence. Second, the gRNA, which
guides the nuclease to the target sequence, needs to bind to a
complementary sequence adjacent to the PAM sequence, called the
**protospacer** sequence. The latter can be thought of as a variable
binding motif that can be specified by designing corresponding gRNA
sequences.

The **spacer** sequence is used in the gRNA construct to guide the
CRISPR nuclease to the target **protospacer** sequence in the host
genome.

For DNA-targeting nucleases, the nucleotide sequence of the spacer and
protospacer are identical. For RNA-targeting nucleases, they are the
reverse complement of each other.

While a gRNA spacer sequence may not always uniquely target the host
genome (i.e. it may map to multiple protospacers in the host genome), we
can, for a given reference genome, uniquely identify a protospacer
sequence with a combination of 3 attributes:

- `chr`: chromosome name
- `strand`: forward (+) or reverse (-)
- `pam_site`: genomic coordinate of the first nucleotide of the
  nuclease-specific PAM sequence (e.g. for SpCas9, the “N” in the NGG
  PAM sequence; for AsCas12a, the first “T” of the TTTV PAM sequence)

For CRISPRko, we use an additional genomic coordinate, called
`cut_site`, to represent where the double-stranded break (DSB) occurs.
For SpCas9, the cut site (blunt-ended dsDNA break) is located 4nt
upstream of the pam_site (PAM-proximal editing). For AsCas12a, the 5nt
5’ overhang dsDNA break will cause a cut 19nt after the PAM sequence on
the targeted strand, and 23nt after the PAM sequence on the opposite
strand (PAM-distal editing).

# CRISPRko design

We will illustrate the main functionalities of `crisprDesign` by
performing a common task: designing gRNAs to knock out a coding gene. In
our example, we will design gRNAs for the wildtype SpCas9 nuclease, with
spacers having a length of 20nt.

``` r
library(crisprDesign)
```

## Nuclease specification

The `crisprBase` package provides functionalities to create objects that
store information about CRISPR nucleases, and functions to interact with
those objects (see the `crisprBase` vignette). It also provides
commonly-used CRISPR nucleases. Let’s look at the `SpCas9` nuclease
object:

``` r
library(crisprBase)
data(SpCas9, package="crisprBase")
SpCas9
```

## Class: CrisprNuclease
    ##   Name: SpCas9
    ##   Target type: DNA
    ##   Metadata: list of length 1
    ##   PAMs: NGG, NAG, NGA
    ##   Weights: 1, 0.2593, 0.0694
    ##   Spacer length: 20
    ##   PAM side: 3prime
    ##     Distance from PAM: 0
    ##   Prototype protospacers: 5'--SSSSSSSSSSSSSSSSSSSS[NGG]--3', 5'--SSSSSSSSSSSSSSSSSSSS[NAG]--3', 5'--SSSSSSSSSSSSSSSSSSSS[NGA]--3'

The three motifs (NGG, NAG and NGA) represent the recognized PAM
sequences by SpCas9, and the weights indicate a recognition score. The
canonical PAM sequence NGG is fully recognized (weight of 1), while the
two non-canonical PAM sequences NAG and NGA are much less tolerated.

The spacer sequence is located on the 5-prime end with respect to the
PAM sequence, and the default spacer sequence length is 20 nucleotides.
If necessary, we can change the spacer length using the function
`crisprBase::spacerLength`. Let’s see what the protospacer construct
looks like by using `prototypeSequence`:

``` r
prototypeSequence(SpCas9)
```

## [1] "5'--SSSSSSSSSSSSSSSSSSSS[NGG]--3'"

## Target DNA specification

As an example, we will design gRNAs that knockout the human gene IQSEC3
by finding all protospacer sequences located in the coding region (CDS)
of IQSEC3.

To do so, we need to create a `GRanges` object that defines the genomic
coordinates of the CDS of IQSEC3 in a reference genome.

The toy dataset `grListExample` object in `crisprDesign` contains gene
coordinates in hg38 for exons of all human IQSEC3 isoforms, and was
obtained by converting an Ensembl `TxDb` object into a `GRangesList`
object using the `TxDb2GRangesList` convenience function in
`crisprDesign`.

``` r
data(grListExample, package="crisprDesign")
```

The `queryTxObject` function allows us to query such objects for a
specific gene and feature. Here, we obtain a `GRanges` object containing
the CDS coordinates of IQSEC3:

``` r
gr <- queryTxObject(txObject=grListExample,
                    featureType="cds",
                    queryColumn="gene_symbol",
                    queryValue="IQSEC3")
```

We will only consider the first exon to speed up design:

``` r
gr <- gr[1]
```

## Designing spacer sequences

`findSpacers` is the main function to obtain a list of all possible
spacer sequences targeting protospacers located in the target DNA
sequence(s). If a `GRanges` object is provided as input, a `BSgenome`
object (object containing sequences of a reference genome) will need to
be provided as well:

``` r
library(BSgenome.Hsapiens.UCSC.hg38)
bsgenome <- BSgenome.Hsapiens.UCSC.hg38
guideSet <- findSpacers(gr,
                        bsgenome=bsgenome,
                        crisprNuclease=SpCas9)
guideSet
```

## GuideSet object with 123 ranges and 5 metadata columns:
    ##              seqnames    ranges strand |          protospacer            pam
    ##                 <Rle> <IRanges>  <Rle> |       <DNAStringSet> <DNAStringSet>
    ##     spacer_1    chr12     66893      - | CGCGCACCGGATTCTCCAGC            AGG
    ##     spacer_2    chr12     66896      + | GGGCGGCATGGAGAGCCTGC            TGG
    ##     spacer_3    chr12     66905      + | GGAGAGCCTGCTGGAGAATC            CGG
    ##     spacer_4    chr12     66906      - | AGGTAGAGCACGGCGCGCAC            CGG
    ##     spacer_5    chr12     66916      - | GAGCTCCTTGAGGTAGAGCA            CGG
    ##          ...      ...       ...    ... .                  ...            ...
    ##   spacer_119    chr12     67407      + | CACAAATCCCCCTCCGCCCT            CGG
    ##   spacer_120    chr12     67412      + | ATCCCCCTCCGCCCTCGGCA            AGG
    ##   spacer_121    chr12     67413      + | TCCCCCTCCGCCCTCGGCAA            GGG
    ##   spacer_122    chr12     67421      - | CTCACTCAGGTCTCCTGCTC            AGG
    ##   spacer_123    chr12     67426      + | TCGGCAAGGGCGTCCTGAGC            AGG
    ##               pam_site  cut_site      region
    ##              <numeric> <numeric> <character>
    ##     spacer_1     66893     66896    region_1
    ##     spacer_2     66896     66893    region_1
    ##     spacer_3     66905     66902    region_1
    ##     spacer_4     66906     66909    region_1
    ##     spacer_5     66916     66919    region_1
    ##          ...       ...       ...         ...
    ##   spacer_119     67407     67404    region_1
    ##   spacer_120     67412     67409    region_1
    ##   spacer_121     67413     67410    region_1
    ##   spacer_122     67421     67424    region_1
    ##   spacer_123     67426     67423    region_1
    ##   -------
    ##   seqinfo: 640 sequences (1 circular) from hg38 genome
    ##   crisprNuclease: SpCas9

This returns a `GuideSet` object that stores genomic coordinates for all
spacer sequences found in the regions provided by `gr`. The `GuideSet`
object is an extension of a `GenomicRanges` object that stores
additional information about gRNAs.

For the subsequent sections, we will only work with a random subset of
20 spacer sequences:

``` r
set.seed(10)
guideSet <- guideSet[sample(seq_along((guideSet)),20)]
```

Several accessor functions are provided to extract information about the
spacer sequences:

``` r
spacers(guideSet)
```

## DNAStringSet object of length 20:
    ##      width seq                                              names               
    ##  [1]    20 CCGAGTTGCTGCGCTGCTGC                             spacer_107
    ##  [2]    20 GCTCTGCTGGTTCTGCACGA                             spacer_9
    ##  [3]    20 CGGCCGCCGCGTCAGCACCA                             spacer_74
    ##  [4]    20 GCCCTTGCCGAGGGCGGAGG                             spacer_112
    ##  [5]    20 GGCCCCGCTGGGGCTGCTCC                             spacer_76
    ##  ...   ... ...
    ## [16]    20 TCCCCCTCCGCCCTCGGCAA                             spacer_121
    ## [17]    20 CGGCAGCGGGGCCGATGACG                             spacer_34
    ## [18]    20 GACGAGCCCGGGCGGAGGCT                             spacer_24
    ## [19]    20 CTCGTCGATACGCTCTCGCT                             spacer_13
    ## [20]    20 CAGTCGCCCCACAAGCATCT                             spacer_95

``` r
protospacers(guideSet)
```

``` r
pams(guideSet)
```

## DNAStringSet object of length 20:
    ##      width seq                                              names               
    ##  [1]     3 CGG                                              spacer_107
    ##  [2]     3 TGG                                              spacer_9
    ##  [3]     3 CGG                                              spacer_74
    ##  [4]     3 GGG                                              spacer_112
    ##  [5]     3 AGG                                              spacer_76
    ##  ...   ... ...
    ## [16]     3 GGG                                              spacer_121
    ## [17]     3 GGG                                              spacer_34
    ## [18]     3 GGG                                              spacer_24
    ## [19]     3 GGG                                              spacer_13
    ## [20]     3 GGG                                              spacer_95

``` r
head(pamSites(guideSet))
```

## spacer_107   spacer_9  spacer_74 spacer_112  spacer_76  spacer_55 
    ##      67371      66943      67233      67396      67244      67153

``` r
head(cutSites(guideSet))
```

## spacer_107   spacer_9  spacer_74 spacer_112  spacer_76  spacer_55 
    ##      67368      66946      67230      67399      67247      67156

The genomic locations stored in the IRanges represent the PAM site
locations in the reference genome.

## Sequence features characterization

There are specific spacer sequence features, independent of the genomic
context of the protospacer sequence, that can reduce or even eliminate
gRNA activity:

- **Poly-T stretches**: four or more consecutive T nucleotides in the
  spacer sequence may act as a transcriptional termination signal for
  the U6 promoter.
- **Self-complementarity**: complementary sites with the gRNA backbone
  can compete with the targeted genomic sequence.
- **Percent GC**: gRNAs with GC content between 20% and 80% are
  preferred.

Use the function `addSequenceFeatures` to adds these spacer sequence
characteristics to the `GuideSet` object:

``` r
guideSet <- addSequenceFeatures(guideSet)
head(guideSet)
```

## GuideSet object with 6 ranges and 12 metadata columns:
    ##              seqnames    ranges strand |          protospacer            pam
    ##                 <Rle> <IRanges>  <Rle> |       <DNAStringSet> <DNAStringSet>
    ##   spacer_107    chr12     67371      + | CCGAGTTGCTGCGCTGCTGC            CGG
    ##     spacer_9    chr12     66943      - | GCTCTGCTGGTTCTGCACGA            TGG
    ##    spacer_74    chr12     67233      + | CGGCCGCCGCGTCAGCACCA            CGG
    ##   spacer_112    chr12     67396      - | GCCCTTGCCGAGGGCGGAGG            GGG
    ##    spacer_76    chr12     67244      - | GGCCCCGCTGGGGCTGCTCC            AGG
    ##    spacer_55    chr12     67153      - | CTGGTCCTGGAGAGGTTCCT            GGG
    ##               pam_site  cut_site      region percentGC     polyA     polyC
    ##              <numeric> <numeric> <character> <numeric> <logical> <logical>
    ##   spacer_107     67371     67368    region_1        70     FALSE     FALSE
    ##     spacer_9     66943     66946    region_1        60     FALSE     FALSE
    ##    spacer_74     67233     67230    region_1        80     FALSE     FALSE
    ##   spacer_112     67396     67399    region_1        80     FALSE     FALSE
    ##    spacer_76     67244     67247    region_1        85     FALSE      TRUE
    ##    spacer_55     67153     67156    region_1        60     FALSE     FALSE
    ##                  polyG     polyT startingGGGGG        NNGG
    ##              <logical> <logical>     <logical> <character>
    ##   spacer_107     FALSE     FALSE         FALSE        CCGG
    ##     spacer_9     FALSE     FALSE         FALSE        ATGG
    ##    spacer_74     FALSE     FALSE         FALSE        ACGG
    ##   spacer_112     FALSE     FALSE         FALSE        GGGG
    ##    spacer_76      TRUE     FALSE         FALSE        CAGG
    ##    spacer_55     FALSE     FALSE         FALSE        TGGG
    ##   -------
    ##   seqinfo: 640 sequences (1 circular) from hg38 genome
    ##   crisprNuclease: SpCas9

## Off-target search

In order to select gRNAs that are most specific to our target of
interest, it is important to avoid gRNAs that target additional loci in
the genome with either perfect sequence complementarity (multiple
on-targets), or imperfect complementarity through tolerated mismatches
(off-targets).

For instance, both the SpCas9 and AsCas12a nucleases can be tolerant to
mismatches between the gRNA spacer sequence (RNA) and the protospacer
sequence (DNA), thereby making it critical to characterize off-targets
to minimize the introduction of double-stranded breaks (DSBs) beyond our
intended target.

The `addSpacerAlignments` function appends a list of putative on- and
off-targets to a `GuideSet` object using one of three methods. The first
method uses the fast aligner
[bowtie](http://bowtie-bio.sourceforge.net/index.shtml) (Langmead et al.
2009) via the `crisprBowtie` package to map spacer sequences to a
specified reference genome. This can be done by specifying
`aligner="bowtie"` in `addSpacerAlignments`.

The second method uses the fast aligner
[BWA](https://github.com/lh3/bwa) via the `crisprBwa` package to map
spacer sequences to a specified reference genome. This can be done by
specifying `aligner="bwa"` in `addSpacerAlignments`. Note that this is
not available for Windows machines.

The third method uses the package `Biostrings` to search for similar
sequences in a set of DNA coordinates sequences, usually provided
through a `BSGenome` object. This can be done by specifying
`aligner="biostrings"` in `addSpacerAlignments`. This is extremely slow,
but can be useful when searching for off-targets in custom short DNA
sequences.

We can control the alignment parameters and output using several
function arguments. `n_mismatches` sets the maximum number of permitted
gRNA:DNA mismatches (up to 3 mismatches). `n_max_alignments` specifies
the maximum number of alignments for a given gRNA spacer sequence (1000
by default). The `n_max_alignments` parameter may be overruled by
setting `all_Possible_alignments=TRUE`, which returns all possible
alignments. `canonical=TRUE` filters out protospacer sequences that do
not have a canonical PAM sequence.

Finally, the `txObject` argument in `addSpacerAlignmentsused` allows
users to provide a `TxDb` object, or a `TxDb` object converted in a
`GRangesList` using the `TxDb2GRangesList` function, to annotate genomic
alignments with a gene model annotation. This is useful to understand
whether or not off-targets are located in the CDS of another gene, for
instance.

For the sake of time, we will search here for on- and off-targets
located in the beginning of the human chr12 where the gene IQSEC3 is
located. We will the bowtie method, with a maximum of 1 mismatch.

First, we need to build a bowtie index sequence using the fasta file
provided in `crisprDesign`. We use the `RBowtie` package to build the
index:

``` r
library(Rbowtie)
fasta <- system.file(package="crisprDesign", "fasta/chr12.fa")
outdir <- tempdir()
Rbowtie::bowtie_build(fasta,
                      outdir=outdir,
                      force=TRUE,
                      prefix="chr12")
bowtie_index <- file.path(outdir, "chr12")
```

For genome-wide off-target search, users will need to create a bowtie
index on the whole genome. This is explained in [this
tutorial](https://github.com/crisprVerse/Tutorials/tree/master/Building_Genome_Indices).

Finally, we also need to specify a `BSgenome` object storing DNA
sequences of the human reference genome:

``` r
library(BSgenome.Hsapiens.UCSC.hg38)
bsgenome <- BSgenome.Hsapiens.UCSC.hg38
```

We are now ready to search for on- and off-targets:

``` r
guideSet <- addSpacerAlignments(guideSet,
                                txObject=grListExample,
                                aligner_index=bowtie_index,
                                bsgenome=bsgenome,
                                n_mismatches=1)
```

## Loading required namespace: crisprBwa

Let’s look at what was added to the `GuideSet`:

``` r
guideSet
```

## GuideSet object with 20 ranges and 17 metadata columns:
    ##              seqnames    ranges strand |          protospacer            pam
    ##                 <Rle> <IRanges>  <Rle> |       <DNAStringSet> <DNAStringSet>
    ##   spacer_107    chr12     67371      + | CCGAGTTGCTGCGCTGCTGC            CGG
    ##     spacer_9    chr12     66943      - | GCTCTGCTGGTTCTGCACGA            TGG
    ##    spacer_74    chr12     67233      + | CGGCCGCCGCGTCAGCACCA            CGG
    ##   spacer_112    chr12     67396      - | GCCCTTGCCGAGGGCGGAGG            GGG
    ##    spacer_76    chr12     67244      - | GGCCCCGCTGGGGCTGCTCC            AGG
    ##          ...      ...       ...    ... .                  ...            ...
    ##   spacer_121    chr12     67413      + | TCCCCCTCCGCCCTCGGCAA            GGG
    ##    spacer_34    chr12     67093      - | CGGCAGCGGGGCCGATGACG            GGG
    ##    spacer_24    chr12     67069      - | GACGAGCCCGGGCGGAGGCT            GGG
    ##    spacer_13    chr12     66976      - | CTCGTCGATACGCTCTCGCT            GGG
    ##    spacer_95    chr12     67308      + | CAGTCGCCCCACAAGCATCT            GGG
    ##               pam_site  cut_site      region percentGC     polyA     polyC
    ##              <numeric> <numeric> <character> <numeric> <logical> <logical>
    ##   spacer_107     67371     67368    region_1        70     FALSE     FALSE
    ##     spacer_9     66943     66946    region_1        60     FALSE     FALSE
    ##    spacer_74     67233     67230    region_1        80     FALSE     FALSE
    ##   spacer_112     67396     67399    region_1        80     FALSE     FALSE
    ##    spacer_76     67244     67247    region_1        85     FALSE      TRUE
    ##          ...       ...       ...         ...       ...       ...       ...
    ##   spacer_121     67413     67410    region_1        75     FALSE      TRUE
    ##    spacer_34     67093     67096    region_1        80     FALSE     FALSE
    ##    spacer_24     67069     67072    region_1        80     FALSE     FALSE
    ##    spacer_13     66976     66979    region_1        60     FALSE     FALSE
    ##    spacer_95     67308     67305    region_1        60     FALSE      TRUE
    ##                  polyG     polyT startingGGGGG        NNGG        n0        n1
    ##              <logical> <logical>     <logical> <character> <numeric> <numeric>
    ##   spacer_107     FALSE     FALSE         FALSE        CCGG         1         0
    ##     spacer_9     FALSE     FALSE         FALSE        ATGG         1         0
    ##    spacer_74     FALSE     FALSE         FALSE        ACGG         1         0
    ##   spacer_112     FALSE     FALSE         FALSE        GGGG         1         0
    ##    spacer_76      TRUE     FALSE         FALSE        CAGG         1         0
    ##          ...       ...       ...           ...         ...       ...       ...
    ##   spacer_121     FALSE     FALSE         FALSE        AGGG         1         0
    ##    spacer_34      TRUE     FALSE         FALSE        GGGG         1         0
    ##    spacer_24     FALSE     FALSE         FALSE        TGGG         1         0
    ##    spacer_13     FALSE     FALSE         FALSE        TGGG         1         0
    ##    spacer_95     FALSE     FALSE         FALSE        TGGG         1         0
    ##                   n0_c      n1_c    alignments
    ##              <numeric> <numeric> <GRangesList>
    ##   spacer_107         1         0 chr12:67371:+
    ##     spacer_9         1         0 chr12:66943:-
    ##    spacer_74         1         0 chr12:67233:+
    ##   spacer_112         1         0 chr12:67396:-
    ##    spacer_76         1         0 chr12:67244:-
    ##          ...       ...       ...           ...
    ##   spacer_121         1         0 chr12:67413:+
    ##    spacer_34         1         0 chr12:67093:-
    ##    spacer_24         1         0 chr12:67069:-
    ##    spacer_13         1         0 chr12:66976:-
    ##    spacer_95         1         0 chr12:67308:+
    ##   -------
    ##   seqinfo: 640 sequences (1 circular) from hg38 genome
    ##   crisprNuclease: SpCas9

A few columns were added to the `GuideSet` object to summarize the
number of on- and off-targets for each spacer sequence, taking into
account genomic context:

- **n0, n1, n2, n3**: specify number of alignments with 0, 1, 2 and 3
  mismatches, respectively.
- **n0_c, n1_c, n2_c, n3_c**: specify number of alignments in a coding
  region, with 0, 1, 2 and 3 mismatches, respectively.
- **n0_p, n1_p, n2_p, n3_p**: specify number of alignments in a promoter
  region of a coding gene, with 0, 1, 2 and 3 mismatches, respectively.

To look at the individual on- and off-targets and their context, use the
`alignments` function to retrieve a table of all genomic alignments
stored in the `GuideSet` object:

``` r
alignments(guideSet)
```

## GRanges object with 20 ranges and 14 metadata columns:
    ##              seqnames    ranges strand |               spacer
    ##                 <Rle> <IRanges>  <Rle> |       <DNAStringSet>
    ##   spacer_107    chr12     67371      + | CCGAGTTGCTGCGCTGCTGC
    ##     spacer_9    chr12     66943      - | GCTCTGCTGGTTCTGCACGA
    ##    spacer_74    chr12     67233      + | CGGCCGCCGCGTCAGCACCA
    ##   spacer_112    chr12     67396      - | GCCCTTGCCGAGGGCGGAGG
    ##    spacer_76    chr12     67244      - | GGCCCCGCTGGGGCTGCTCC
    ##          ...      ...       ...    ... .                  ...
    ##   spacer_121    chr12     67413      + | TCCCCCTCCGCCCTCGGCAA
    ##    spacer_34    chr12     67093      - | CGGCAGCGGGGCCGATGACG
    ##    spacer_24    chr12     67069      - | GACGAGCCCGGGCGGAGGCT
    ##    spacer_13    chr12     66976      - | CTCGTCGATACGCTCTCGCT
    ##    spacer_95    chr12     67308      + | CAGTCGCCCCACAAGCATCT
    ##                       protospacer            pam  pam_site n_mismatches
    ##                    <DNAStringSet> <DNAStringSet> <numeric>    <integer>
    ##   spacer_107 CCGAGTTGCTGCGCTGCTGC            CGG     67371            0
    ##     spacer_9 GCTCTGCTGGTTCTGCACGA            TGG     66943            0
    ##    spacer_74 CGGCCGCCGCGTCAGCACCA            CGG     67233            0
    ##   spacer_112 GCCCTTGCCGAGGGCGGAGG            GGG     67396            0
    ##    spacer_76 GGCCCCGCTGGGGCTGCTCC            AGG     67244            0
    ##          ...                  ...            ...       ...          ...
    ##   spacer_121 TCCCCCTCCGCCCTCGGCAA            GGG     67413            0
    ##    spacer_34 CGGCAGCGGGGCCGATGACG            GGG     67093            0
    ##    spacer_24 GACGAGCCCGGGCGGAGGCT            GGG     67069            0
    ##    spacer_13 CTCGTCGATACGCTCTCGCT            GGG     66976            0
    ##    spacer_95 CAGTCGCCCCACAAGCATCT            GGG     67308            0
    ##              canonical  cut_site         cds    fiveUTRs   threeUTRs
    ##              <logical> <numeric> <character> <character> <character>
    ##   spacer_107      TRUE     67368      IQSEC3        <NA>        <NA>
    ##     spacer_9      TRUE     66946      IQSEC3        <NA>        <NA>
    ##    spacer_74      TRUE     67230      IQSEC3        <NA>        <NA>
    ##   spacer_112      TRUE     67399      IQSEC3        <NA>        <NA>
    ##    spacer_76      TRUE     67247      IQSEC3        <NA>        <NA>
    ##          ...       ...       ...         ...         ...         ...
    ##   spacer_121      TRUE     67410      IQSEC3        <NA>        <NA>
    ##    spacer_34      TRUE     67096      IQSEC3        <NA>        <NA>
    ##    spacer_24      TRUE     67072      IQSEC3        <NA>        <NA>
    ##    spacer_13      TRUE     66979      IQSEC3        <NA>        <NA>
    ##    spacer_95      TRUE     67305      IQSEC3        <NA>        <NA>
    ##                    exons     introns  intergenic intergenic_distance
    ##              <character> <character> <character>           <integer>
    ##   spacer_107      IQSEC3        <NA>        <NA>                <NA>
    ##     spacer_9      IQSEC3        <NA>        <NA>                <NA>
    ##    spacer_74      IQSEC3        <NA>        <NA>                <NA>
    ##   spacer_112      IQSEC3        <NA>        <NA>                <NA>
    ##    spacer_76      IQSEC3        <NA>        <NA>                <NA>
    ##          ...         ...         ...         ...                 ...
    ##   spacer_121      IQSEC3        <NA>        <NA>                <NA>
    ##    spacer_34      IQSEC3        <NA>        <NA>                <NA>
    ##    spacer_24      IQSEC3        <NA>        <NA>                <NA>
    ##    spacer_13      IQSEC3        <NA>        <NA>                <NA>
    ##    spacer_95      IQSEC3        <NA>        <NA>                <NA>
    ##   -------
    ##   seqinfo: 25 sequences (1 circular) from hg38 genome

The functions `onTargets` and `offTargets` will return on-target
alignments (no mismatch) and off-target alignment (with at least one
mismatch), respectively. See `?addSpacerAlignments` for more details
about the different options.

### Iterative spacer alignments

gRNAs that align to hundreds of different locations are highly
unspecific and undesirable. This can also cause `addSpacerAlignments` to
be slow. To mitigate this, we provide `addSpacerAlignmentsIterative`, an
iterative version of `addSpacerAlignments` that curtails alignment
searches for gRNAs having more hits than the user-defined threshold (see
`?addSpacerAlignmentsIterative`).

### Faster alignment by removing repeat elements

To remove protospacer sequences located in repeats or low-complexity DNA
sequences (regions identified by RepeatMasker), which are usually not of
interest due to their low specificity, we provide the convenience
function `removeRepeats`:

``` r
data(grRepeatsExample, package="crisprDesign")
guideSet <- removeRepeats(guideSet,
                          gr.repeats=grRepeatsExample)
```

## Off-target scoring

After retrieving a list of putative off-targets and on-targets for a
given spacer sequence, we can use `addOffTargetScores` to predict the
likelihood of the nuclease to cut at the off-targets based on mismatch
tolerance. Currently, only off-target scoring for the SpCas9 nuclease
are available (MIT and CFD algorithms):

``` r
guideSet <- addOffTargetScores(guideSet)
guideSet
```

## GuideSet object with 17 ranges and 20 metadata columns:
    ##              seqnames    ranges strand |          protospacer            pam
    ##                 <Rle> <IRanges>  <Rle> |       <DNAStringSet> <DNAStringSet>
    ##   spacer_107    chr12     67371      + | CCGAGTTGCTGCGCTGCTGC            CGG
    ##     spacer_9    chr12     66943      - | GCTCTGCTGGTTCTGCACGA            TGG
    ##    spacer_74    chr12     67233      + | CGGCCGCCGCGTCAGCACCA            CGG
    ##   spacer_112    chr12     67396      - | GCCCTTGCCGAGGGCGGAGG            GGG
    ##    spacer_76    chr12     67244      - | GGCCCCGCTGGGGCTGCTCC            AGG
    ##          ...      ...       ...    ... .                  ...            ...
    ##    spacer_71    chr12     67218      - | TGTCCGTGGTGCTGACGCGG            CGG
    ##   spacer_121    chr12     67413      + | TCCCCCTCCGCCCTCGGCAA            GGG
    ##    spacer_24    chr12     67069      - | GACGAGCCCGGGCGGAGGCT            GGG
    ##    spacer_13    chr12     66976      - | CTCGTCGATACGCTCTCGCT            GGG
    ##    spacer_95    chr12     67308      + | CAGTCGCCCCACAAGCATCT            GGG
    ##               pam_site  cut_site      region percentGC     polyA     polyC
    ##              <numeric> <numeric> <character> <numeric> <logical> <logical>
    ##   spacer_107     67371     67368    region_1        70     FALSE     FALSE
    ##     spacer_9     66943     66946    region_1        60     FALSE     FALSE
    ##    spacer_74     67233     67230    region_1        80     FALSE     FALSE
    ##   spacer_112     67396     67399    region_1        80     FALSE     FALSE
    ##    spacer_76     67244     67247    region_1        85     FALSE      TRUE
    ##          ...       ...       ...         ...       ...       ...       ...
    ##    spacer_71     67218     67221    region_1        70     FALSE     FALSE
    ##   spacer_121     67413     67410    region_1        75     FALSE      TRUE
    ##    spacer_24     67069     67072    region_1        80     FALSE     FALSE
    ##    spacer_13     66976     66979    region_1        60     FALSE     FALSE
    ##    spacer_95     67308     67305    region_1        60     FALSE      TRUE
    ##                  polyG     polyT startingGGGGG        NNGG        n0        n1
    ##              <logical> <logical>     <logical> <character> <numeric> <numeric>
    ##   spacer_107     FALSE     FALSE         FALSE        CCGG         1         0
    ##     spacer_9     FALSE     FALSE         FALSE        ATGG         1         0
    ##    spacer_74     FALSE     FALSE         FALSE        ACGG         1         0
    ##   spacer_112     FALSE     FALSE         FALSE        GGGG         1         0
    ##    spacer_76      TRUE     FALSE         FALSE        CAGG         1         0
    ##          ...       ...       ...           ...         ...       ...       ...
    ##    spacer_71     FALSE     FALSE         FALSE        GCGG         1         0
    ##   spacer_121     FALSE     FALSE         FALSE        AGGG         1         0
    ##    spacer_24     FALSE     FALSE         FALSE        TGGG         1         0
    ##    spacer_13     FALSE     FALSE         FALSE        TGGG         1         0
    ##    spacer_95     FALSE     FALSE         FALSE        TGGG         1         0
    ##                   n0_c      n1_c    alignments inRepeats score_cfd score_mit
    ##              <numeric> <numeric> <GRangesList> <logical> <numeric> <numeric>
    ##   spacer_107         1         0 chr12:67371:+     FALSE         1         1
    ##     spacer_9         1         0 chr12:66943:-     FALSE         1         1
    ##    spacer_74         1         0 chr12:67233:+     FALSE         1         1
    ##   spacer_112         1         0 chr12:67396:-     FALSE         1         1
    ##    spacer_76         1         0 chr12:67244:-     FALSE         1         1
    ##          ...       ...       ...           ...       ...       ...       ...
    ##    spacer_71         1         0 chr12:67218:-     FALSE         1         1
    ##   spacer_121         1         0 chr12:67413:+     FALSE         1         1
    ##    spacer_24         1         0 chr12:67069:-     FALSE         1         1
    ##    spacer_13         1         0 chr12:66976:-     FALSE         1         1
    ##    spacer_95         1         0 chr12:67308:+     FALSE         1         1
    ##   -------
    ##   seqinfo: 640 sequences (1 circular) from hg38 genome
    ##   crisprNuclease: SpCas9

Note that this will only work after calling `addSpacerAlignments`, as it
requires a list of off-targets for each gRNA entry. The returned
`GuideSet` object has now the additional columns `score_mit` and
`score_cfd` representing the gRNA-level aggregated off-target
specificity scores. The off-target table also contains a cutting
likelihood score for each gRNA and off-target pair:

``` r
head(alignments(guideSet))
```

## GRanges object with 6 ranges and 16 metadata columns:
    ##              seqnames    ranges strand |               spacer
    ##                 <Rle> <IRanges>  <Rle> |       <DNAStringSet>
    ##   spacer_107    chr12     67371      + | CCGAGTTGCTGCGCTGCTGC
    ##     spacer_9    chr12     66943      - | GCTCTGCTGGTTCTGCACGA
    ##    spacer_74    chr12     67233      + | CGGCCGCCGCGTCAGCACCA
    ##   spacer_112    chr12     67396      - | GCCCTTGCCGAGGGCGGAGG
    ##    spacer_76    chr12     67244      - | GGCCCCGCTGGGGCTGCTCC
    ##    spacer_55    chr12     67153      - | CTGGTCCTGGAGAGGTTCCT
    ##                       protospacer            pam  pam_site n_mismatches
    ##                    <DNAStringSet> <DNAStringSet> <numeric>    <integer>
    ##   spacer_107 CCGAGTTGCTGCGCTGCTGC            CGG     67371            0
    ##     spacer_9 GCTCTGCTGGTTCTGCACGA            TGG     66943            0
    ##    spacer_74 CGGCCGCCGCGTCAGCACCA            CGG     67233            0
    ##   spacer_112 GCCCTTGCCGAGGGCGGAGG            GGG     67396            0
    ##    spacer_76 GGCCCCGCTGGGGCTGCTCC            AGG     67244            0
    ##    spacer_55 CTGGTCCTGGAGAGGTTCCT            GGG     67153            0
    ##              canonical  cut_site         cds    fiveUTRs   threeUTRs
    ##              <logical> <numeric> <character> <character> <character>
    ##   spacer_107      TRUE     67368      IQSEC3        <NA>        <NA>
    ##     spacer_9      TRUE     66946      IQSEC3        <NA>        <NA>
    ##    spacer_74      TRUE     67230      IQSEC3        <NA>        <NA>
    ##   spacer_112      TRUE     67399      IQSEC3        <NA>        <NA>
    ##    spacer_76      TRUE     67247      IQSEC3        <NA>        <NA>
    ##    spacer_55      TRUE     67156      IQSEC3        <NA>        <NA>
    ##                    exons     introns  intergenic intergenic_distance score_cfd
    ##              <character> <character> <character>           <integer> <numeric>
    ##   spacer_107      IQSEC3        <NA>        <NA>                <NA>         1
    ##     spacer_9      IQSEC3        <NA>        <NA>                <NA>         1
    ##    spacer_74      IQSEC3        <NA>        <NA>                <NA>         1
    ##   spacer_112      IQSEC3        <NA>        <NA>                <NA>         1
    ##    spacer_76      IQSEC3        <NA>        <NA>                <NA>         1
    ##    spacer_55      IQSEC3        <NA>        <NA>                <NA>         1
    ##              score_mit
    ##              <numeric>
    ##   spacer_107         1
    ##     spacer_9         1
    ##    spacer_74         1
    ##   spacer_112         1
    ##    spacer_76         1
    ##    spacer_55         1
    ##   -------
    ##   seqinfo: 25 sequences (1 circular) from hg38 genome

## On-target scoring

`addOnTargetScores` adds scores from all on-target efficiency algorithms
available in the R package `crisprScore` and appends them to the
`GuideSet`. By default, scores for all available methods for a given
nuclease will be computed. Here, for the sake of time, let’s add only
the CRISPRater score:

``` r
guideSet <- addOnTargetScores(guideSet, methods="crisprater")
head(guideSet)
```

## GuideSet object with 6 ranges and 21 metadata columns:
    ##              seqnames    ranges strand |          protospacer            pam
    ##                 <Rle> <IRanges>  <Rle> |       <DNAStringSet> <DNAStringSet>
    ##   spacer_107    chr12     67371      + | CCGAGTTGCTGCGCTGCTGC            CGG
    ##     spacer_9    chr12     66943      - | GCTCTGCTGGTTCTGCACGA            TGG
    ##    spacer_74    chr12     67233      + | CGGCCGCCGCGTCAGCACCA            CGG
    ##   spacer_112    chr12     67396      - | GCCCTTGCCGAGGGCGGAGG            GGG
    ##    spacer_76    chr12     67244      - | GGCCCCGCTGGGGCTGCTCC            AGG
    ##    spacer_55    chr12     67153      - | CTGGTCCTGGAGAGGTTCCT            GGG
    ##               pam_site  cut_site      region percentGC     polyA     polyC
    ##              <numeric> <numeric> <character> <numeric> <logical> <logical>
    ##   spacer_107     67371     67368    region_1        70     FALSE     FALSE
    ##     spacer_9     66943     66946    region_1        60     FALSE     FALSE
    ##    spacer_74     67233     67230    region_1        80     FALSE     FALSE
    ##   spacer_112     67396     67399    region_1        80     FALSE     FALSE
    ##    spacer_76     67244     67247    region_1        85     FALSE      TRUE
    ##    spacer_55     67153     67156    region_1        60     FALSE     FALSE
    ##                  polyG     polyT startingGGGGG        NNGG        n0        n1
    ##              <logical> <logical>     <logical> <character> <numeric> <numeric>
    ##   spacer_107     FALSE     FALSE         FALSE        CCGG         1         0
    ##     spacer_9     FALSE     FALSE         FALSE        ATGG         1         0
    ##    spacer_74     FALSE     FALSE         FALSE        ACGG         1         0
    ##   spacer_112     FALSE     FALSE         FALSE        GGGG         1         0
    ##    spacer_76      TRUE     FALSE         FALSE        CAGG         1         0
    ##    spacer_55     FALSE     FALSE         FALSE        TGGG         1         0
    ##                   n0_c      n1_c    alignments inRepeats score_cfd score_mit
    ##              <numeric> <numeric> <GRangesList> <logical> <numeric> <numeric>
    ##   spacer_107         1         0 chr12:67371:+     FALSE         1         1
    ##     spacer_9         1         0 chr12:66943:-     FALSE         1         1
    ##    spacer_74         1         0 chr12:67233:+     FALSE         1         1
    ##   spacer_112         1         0 chr12:67396:-     FALSE         1         1
    ##    spacer_76         1         0 chr12:67244:-     FALSE         1         1
    ##    spacer_55         1         0 chr12:67153:-     FALSE         1         1
    ##              score_crisprater
    ##                     <numeric>
    ##   spacer_107         0.782780
    ##     spacer_9         0.834319
    ##    spacer_74         0.764870
    ##   spacer_112         0.795745
    ##    spacer_76         0.755493
    ##    spacer_55         0.711902
    ##   -------
    ##   seqinfo: 640 sequences (1 circular) from hg38 genome
    ##   crisprNuclease: SpCas9

See the `crisprScore` vignette for a full description of the different
scores.

## Restriction enzymes

Restriction enzymes are usually involved in the gRNA library synthesis
process. Removing gRNAs that contain specific restriction sites is often
necessary. We provide the function `addRestrictionEnzymes` to indicate
whether or not gRNAs contain restriction sites for a user-defined set of
enzymes:

``` r
guideSet <- addRestrictionEnzymes(guideSet)
```

When no enzymes are specified, the function adds annotation for the
following default enzymes: EcoRI, KpnI, BsmBI, BsaI, BbsI, PacI, ISceI
and MluI. The function also has two additional arguments, `flanking5`
and `flanking3`, to specify nucleotide sequences flanking the spacer
sequence (5’ and 3’, respectively) in the lentiviral cassette that will
be used for gRNA delivery. The function will effectively search for
restriction sites in the full sequence `[flanking5][spacer][flanking3]`.

The `enzymeAnnotation` function can be used to retrieve the added
annotation:

``` r
head(enzymeAnnotation(guideSet))
```

## DataFrame with 6 rows and 7 columns
    ##                EcoRI      KpnI     BsmBI      BsaI      BbsI      PacI
    ##            <logical> <logical> <logical> <logical> <logical> <logical>
    ## spacer_107     FALSE     FALSE     FALSE     FALSE     FALSE     FALSE
    ## spacer_9       FALSE     FALSE     FALSE     FALSE     FALSE     FALSE
    ## spacer_74      FALSE     FALSE     FALSE     FALSE     FALSE     FALSE
    ## spacer_112     FALSE     FALSE     FALSE     FALSE     FALSE     FALSE
    ## spacer_76      FALSE     FALSE     FALSE     FALSE     FALSE     FALSE
    ## spacer_55      FALSE     FALSE     FALSE     FALSE     FALSE     FALSE
    ##                 MluI
    ##            <logical>
    ## spacer_107     FALSE
    ## spacer_9       FALSE
    ## spacer_74      FALSE
    ## spacer_112     FALSE
    ## spacer_76      FALSE
    ## spacer_55      FALSE

## Gene annotation

The function `addGeneAnnotation` adds transcript- and gene-level
contextual information to gRNAs from a `TxDb`-like object:

``` r
guideSet <- addGeneAnnotation(guideSet,
                              txObject=grListExample)
```

The gene annotation can be retrieved using the function
`geneAnnotation`:

``` r
geneAnnotation(guideSet)
```

## DataFrame with 17 rows and 24 columns
    ##                 chr anchor_site   strand gene_symbol         gene_id
    ##            <factor>   <integer> <factor> <character>     <character>
    ## spacer_107    chr12       67368        +      IQSEC3 ENSG00000120645
    ## spacer_9      chr12       66946        -      IQSEC3 ENSG00000120645
    ## spacer_74     chr12       67230        +      IQSEC3 ENSG00000120645
    ## spacer_112    chr12       67399        -      IQSEC3 ENSG00000120645
    ## spacer_76     chr12       67247        -      IQSEC3 ENSG00000120645
    ## ...             ...         ...      ...         ...             ...
    ## spacer_71     chr12       67221        -      IQSEC3 ENSG00000120645
    ## spacer_121    chr12       67410        +      IQSEC3 ENSG00000120645
    ## spacer_24     chr12       67072        -      IQSEC3 ENSG00000120645
    ## spacer_13     chr12       66979        -      IQSEC3 ENSG00000120645
    ## spacer_95     chr12       67305        +      IQSEC3 ENSG00000120645
    ##                      tx_id      protein_id         exon_id   cut_cds
    ##                <character>     <character>     <character> <logical>
    ## spacer_107 ENST00000538872 ENSP00000437554 ENSE00002310174      TRUE
    ## spacer_9   ENST00000538872 ENSP00000437554 ENSE00002310174      TRUE
    ## spacer_74  ENST00000538872 ENSP00000437554 ENSE00002310174      TRUE
    ## spacer_112 ENST00000538872 ENSP00000437554 ENSE00002310174      TRUE
    ## spacer_76  ENST00000538872 ENSP00000437554 ENSE00002310174      TRUE
    ## ...                    ...             ...             ...       ...
    ## spacer_71  ENST00000538872 ENSP00000437554 ENSE00002310174      TRUE
    ## spacer_121 ENST00000538872 ENSP00000437554 ENSE00002310174      TRUE
    ## spacer_24  ENST00000538872 ENSP00000437554 ENSE00002310174      TRUE
    ## spacer_13  ENST00000538872 ENSP00000437554 ENSE00002310174      TRUE
    ## spacer_95  ENST00000538872 ENSP00000437554 ENSE00002310174      TRUE
    ##            cut_fiveUTRs cut_threeUTRs cut_introns percentCDS aminoAcidIndex
    ##               <logical>     <logical>   <logical>  <numeric>      <numeric>
    ## spacer_107        FALSE         FALSE       FALSE       13.7            162
    ## spacer_9          FALSE         FALSE       FALSE        1.8             22
    ## spacer_74         FALSE         FALSE       FALSE        9.8            116
    ## spacer_112        FALSE         FALSE       FALSE       14.6            173
    ## spacer_76         FALSE         FALSE       FALSE       10.3            122
    ## ...                 ...           ...         ...        ...            ...
    ## spacer_71         FALSE         FALSE       FALSE        9.6            113
    ## spacer_121        FALSE         FALSE       FALSE       14.9            176
    ## spacer_24         FALSE         FALSE       FALSE        5.4             64
    ## spacer_13         FALSE         FALSE       FALSE        2.7             33
    ## spacer_95         FALSE         FALSE       FALSE       11.9            141
    ##            downtreamATG percentTx nIsoforms totalIsoforms percentIsoforms
    ##               <numeric> <numeric> <integer>     <numeric>       <numeric>
    ## spacer_107            1       8.5         1             2              50
    ## spacer_9              0       2.5         1             2              50
    ## spacer_74             0       6.5         1             2              50
    ## spacer_112            1       8.9         1             2              50
    ## spacer_76             0       6.8         1             2              50
    ## ...                 ...       ...       ...           ...             ...
    ## spacer_71             0       6.4         1             2              50
    ## spacer_121            1       9.1         1             2              50
    ## spacer_24             0       4.3         1             2              50
    ## spacer_13             0       3.0         1             2              50
    ## spacer_95             1       7.6         1             2              50
    ##            isCommonExon nCodingIsoforms totalCodingIsoforms
    ##               <logical>       <integer>           <numeric>
    ## spacer_107        FALSE               1                   2
    ## spacer_9          FALSE               1                   2
    ## spacer_74         FALSE               1                   2
    ## spacer_112        FALSE               1                   2
    ## spacer_76         FALSE               1                   2
    ## ...                 ...             ...                 ...
    ## spacer_71         FALSE               1                   2
    ## spacer_121        FALSE               1                   2
    ## spacer_24         FALSE               1                   2
    ## spacer_13         FALSE               1                   2
    ## spacer_95         FALSE               1                   2
    ##            percentCodingIsoforms isCommonCodingExon
    ##                        <numeric>          <logical>
    ## spacer_107                    50              FALSE
    ## spacer_9                      50              FALSE
    ## spacer_74                     50              FALSE
    ## spacer_112                    50              FALSE
    ## spacer_76                     50              FALSE
    ## ...                          ...                ...
    ## spacer_71                     50              FALSE
    ## spacer_121                    50              FALSE
    ## spacer_24                     50              FALSE
    ## spacer_13                     50              FALSE
    ## spacer_95                     50              FALSE

It contains a lot of information that contextualizes the genomic
location of the protospacer sequences.

The ID columns (`tx_id`, `gene_id`, `protein_id`, `exon_id`) give
Ensembl IDs. The `exon_rank` gives the order of the exon for the
transcript, for example “2” indicates it is the second exon (from the 5’
end) in the mature transcript.

The columns `cut_cds`, `cut_fiveUTRs`, `cut_threeUTRs` and `cut_introns`
indicate whether the guide sequence overlaps with CDS, 5’ UTR, 3’ UTR,
or an intron, respectively.

`percentCDS` gives the location of the `cut_site` within the transcript
as a percent from the 5’ end to the 3’ end. `aminoAcidIndex` gives the
number of the specific amino acid in the protein where the cut is
predicted to occur. `downstreamATG` shows how many in-frame ATGs are
downstream of the `cut_site` (and upstream from the defined percent
transcript cutoff, `met_cutoff`), indicating a potential alternative
translation initiation site that may preserve protein function.

For more information about the other columns, type `?addGeneAnnotation`.

## TSS annotation

Similarly, one might want to know which protospacer sequences are
located within promoter regions of known genes:

``` r
data(tssObjectExample, package="crisprDesign")
guideSet <- addTssAnnotation(guideSet,
                             tssObject=tssObjectExample)
tssAnnotation(guideSet)
```

## DataFrame with 10 rows and 11 columns
    ##                chr anchor_site   strand           tx_id         gene_id
    ##           <factor>   <integer> <factor>     <character>     <character>
    ## spacer_9     chr12       66946        - ENST00000538872 ENSG00000120645
    ## spacer_74    chr12       67230        + ENST00000538872 ENSG00000120645
    ## spacer_76    chr12       67247        - ENST00000538872 ENSG00000120645
    ## spacer_55    chr12       67156        - ENST00000538872 ENSG00000120645
    ## spacer_72    chr12       67224        - ENST00000538872 ENSG00000120645
    ## spacer_54    chr12       67145        + ENST00000538872 ENSG00000120645
    ## spacer_15    chr12       66995        + ENST00000538872 ENSG00000120645
    ## spacer_71    chr12       67221        - ENST00000538872 ENSG00000120645
    ## spacer_24    chr12       67072        - ENST00000538872 ENSG00000120645
    ## spacer_13    chr12       66979        - ENST00000538872 ENSG00000120645
    ##           gene_symbol    promoter      tss_id  tss_strand   tss_pos dist_to_tss
    ##           <character> <character> <character> <character> <integer>   <numeric>
    ## spacer_9       IQSEC3          P1   IQSEC3_P1           +     66767         179
    ## spacer_74      IQSEC3          P1   IQSEC3_P1           +     66767         463
    ## spacer_76      IQSEC3          P1   IQSEC3_P1           +     66767         480
    ## spacer_55      IQSEC3          P1   IQSEC3_P1           +     66767         389
    ## spacer_72      IQSEC3          P1   IQSEC3_P1           +     66767         457
    ## spacer_54      IQSEC3          P1   IQSEC3_P1           +     66767         378
    ## spacer_15      IQSEC3          P1   IQSEC3_P1           +     66767         228
    ## spacer_71      IQSEC3          P1   IQSEC3_P1           +     66767         454
    ## spacer_24      IQSEC3          P1   IQSEC3_P1           +     66767         305
    ## spacer_13      IQSEC3          P1   IQSEC3_P1           +     66767         212

For more information, type `?addTssAnnotation`.

## SNP information

Common single-nucleotide polymorphisms (SNPs) can change the on-target
and off-target properties of gRNAs by altering the binding. The function
`addSNPAnnotation` annotates gRNAs with respect to a reference database
of SNPs (stored in a VCF file), specified by the `vcf` argument.

VCF files for common SNPs (dbSNPs) can be downloaded from NCBI on the
[dbSNP
website](https://www.ncbi.nlm.nih.gov/variation/docs/human_variation_vcf/).
We include in this package an example VCF file for common SNPs located
in the proximity of human gene IQSEC3. This was obtained using the
dbSNP151 RefSNP database obtained by subsetting around IQSEC.

``` r
vcf <- system.file("extdata",
                   file="common_snps_dbsnp151_example.vcf.gz",
                   package="crisprDesign")
guideSet <- addSNPAnnotation(guideSet, vcf=vcf)
snps(guideSet)
```

## DataFrame with 0 rows and 9 columns

The `rs_site_rel` gives the relative position of the SNP with respect to
the `pam_site`. `allele_ref` and `allele_minor` report the nucleotide of
the reference and minor alleles, respectively. `MAF_1000G` and
`MAF_TOPMED` report the minor allele frequency (MAF) in the 1000Genomes
and TOPMED populations.

## Filtering and ranking gRNAs

Once gRNAs are fully annotated, it is easy to filter out any unwanted
gRNAs since `GuideSet` objects can be subsetted like regular vectors in
R.

As an example, suppose that we only want to keep gRNAs that have percent
GC between 20% and 80% and that do not contain a polyT stretch. This can
be achieved using the following lines:

``` r
guideSet <- guideSet[guideSet$percentGC>=20]
guideSet <- guideSet[guideSet$percentGC<=80]
guideSet <- guideSet[!guideSet$polyT]
```

Similarly, it is easy to rank gRNAs based on a set of criteria using the
regular `order` function.

For instance, let’s sort gRNAs by the CRISPRater on-target score:

``` r
# Creating an ordering index based on the CRISPRater score:
# Using the negative values to make sure higher scores are ranked first:
o <- order(-guideSet$score_crisprater) 
# Ordering the GuideSet:
guideSet <- guideSet[o]
head(guideSet)
```

## GuideSet object with 6 ranges and 26 metadata columns:
    ##              seqnames    ranges strand |          protospacer            pam
    ##                 <Rle> <IRanges>  <Rle> |       <DNAStringSet> <DNAStringSet>
    ##     spacer_9    chr12     66943      - | GCTCTGCTGGTTCTGCACGA            TGG
    ##   spacer_112    chr12     67396      - | GCCCTTGCCGAGGGCGGAGG            GGG
    ##   spacer_107    chr12     67371      + | CCGAGTTGCTGCGCTGCTGC            CGG
    ##    spacer_74    chr12     67233      + | CGGCCGCCGCGTCAGCACCA            CGG
    ##    spacer_76    chr12     67244      - | GGCCCCGCTGGGGCTGCTCC            AGG
    ##   spacer_121    chr12     67413      + | TCCCCCTCCGCCCTCGGCAA            GGG
    ##               pam_site  cut_site      region percentGC     polyA     polyC
    ##              <numeric> <numeric> <character> <numeric> <logical> <logical>
    ##     spacer_9     66943     66946    region_1        60     FALSE     FALSE
    ##   spacer_112     67396     67399    region_1        80     FALSE     FALSE
    ##   spacer_107     67371     67368    region_1        70     FALSE     FALSE
    ##    spacer_74     67233     67230    region_1        80     FALSE     FALSE
    ##    spacer_76     67244     67247    region_1        85     FALSE      TRUE
    ##   spacer_121     67413     67410    region_1        75     FALSE      TRUE
    ##                  polyG     polyT startingGGGGG        NNGG        n0        n1
    ##              <logical> <logical>     <logical> <character> <numeric> <numeric>
    ##     spacer_9     FALSE     FALSE         FALSE        ATGG         1         0
    ##   spacer_112     FALSE     FALSE         FALSE        GGGG         1         0
    ##   spacer_107     FALSE     FALSE         FALSE        CCGG         1         0
    ##    spacer_74     FALSE     FALSE         FALSE        ACGG         1         0
    ##    spacer_76      TRUE     FALSE         FALSE        CAGG         1         0
    ##   spacer_121     FALSE     FALSE         FALSE        AGGG         1         0
    ##                   n0_c      n1_c    alignments inRepeats score_cfd score_mit
    ##              <numeric> <numeric> <GRangesList> <logical> <numeric> <numeric>
    ##     spacer_9         1         0 chr12:66943:-     FALSE         1         1
    ##   spacer_112         1         0 chr12:67396:-     FALSE         1         1
    ##   spacer_107         1         0 chr12:67371:+     FALSE         1         1
    ##    spacer_74         1         0 chr12:67233:+     FALSE         1         1
    ##    spacer_76         1         0 chr12:67244:-     FALSE         1         1
    ##   spacer_121         1         0 chr12:67413:+     FALSE         1         1
    ##              score_crisprater      enzymeAnnotation       geneAnnotation
    ##                     <numeric>  <SplitDataFrameList> <SplitDataFrameList>
    ##     spacer_9         0.834319 FALSE:FALSE:FALSE:...    chr12:66946:-:...
    ##   spacer_112         0.795745 FALSE:FALSE:FALSE:...    chr12:67399:-:...
    ##   spacer_107         0.782780 FALSE:FALSE:FALSE:...    chr12:67368:+:...
    ##    spacer_74         0.764870 FALSE:FALSE:FALSE:...    chr12:67230:+:...
    ##    spacer_76         0.755493 FALSE:FALSE:FALSE:...    chr12:67247:-:...
    ##   spacer_121         0.741315 FALSE:FALSE:FALSE:...    chr12:67410:+:...
    ##                     tssAnnotation    hasSNP                 snps
    ##              <SplitDataFrameList> <logical> <SplitDataFrameList>
    ##     spacer_9    chr12:66946:-:...     FALSE             :...,...
    ##   spacer_112             :...,...     FALSE             :...,...
    ##   spacer_107             :...,...     FALSE             :...,...
    ##    spacer_74    chr12:67230:+:...     FALSE             :...,...
    ##    spacer_76    chr12:67247:-:...     FALSE             :...,...
    ##   spacer_121             :...,...     FALSE             :...,...
    ##   -------
    ##   seqinfo: 640 sequences (1 circular) from hg38 genome
    ##   crisprNuclease: SpCas9

One can also sort gRNAs using several annotation columns. For instance,
let’s sort gRNAs using the CRISPRrater score, but also by prioritizing
first gRNAs that have no 1-mismatch off-targets:

``` r
o <- order(guideSet$n1, -guideSet$score_crisprater) 
# Ordering the GuideSet:
guideSet <- guideSet[o]
head(guideSet)
```

The `rankSpacers` function is a convenience function that implements our
recommended rankings for the SpCas9, enAsCas12a and CasRx nucleases. For
a detailed description of our recommended rankings, see the
documentation of `rankSpacers` by typing `?rankSpacers`.

If an Ensembl transcript ID is provided, the ranking function will also
take into account the position of the gRNA within the target CDS of the
transcript ID in the ranking procedure. Our recommendation is to specify
the Ensembl canonical transcript as the representative transcript for
the gene. In our example, ENST00000538872 is the canonical transcript
for IQSEC3:

``` r
tx_id <- "ENST00000538872"
guideSet <- rankSpacers(guideSet,
                        tx_id=tx_id)
```

# CRISPRa/CRISPRi design

For CRISPRa and CRISPRi applications, the CRISPR nuclease is engineered
to lose its endonuclease activity, therefore should not introduce
double-stranded breaks (DSBs). We will use the dead SpCas9 (dSpCas9)
nuclease as an example here. Note that users don’t have to distinguish
between dSpCas9 and SpCas9 when specifying the nuclease in
`crisprDesign` and `crisprBase` as they do not differ in terms of the
characteristics stored in the `CrisprNuclease` object.

*CRISPRi*: Fusing dSpCas9 with a Krüppel-associated box (KRAB) domain
has been shown to be effective at repressing transcription in mammalian
cells (Gilbert et al. 2013). The dSpCas9-KRAB fused protein is a
commonly-used construct to conduct CRISPR inhibition (CRISPRi)
experiments. To achieve optimal inhibition, gRNAs are usually designed
targeting the region directly downstream of the gene transcription
starting site (TSS).

*CRISPRa*: dSpCas9 can also be used to activate gene expression by
coupling the dead nuclease with activation factors. The technology is
termed CRISPR activation (CRISPRa), and several CRISPRa systems have
been developed (see Kampmann (2018) for a review). For optimal
activation, gRNAs are usually designed to target the region directly
upstream of the gene TSS.

`crisprDesign` provides functionalities to be able to take into account
design rules that are specific to CRISPRa and CRISPRi applications. The
`queryTss` function allows to specify genomic coordinates of promoter
regions. The `addTssAnnotation` annotates gRNAs for known TSSs, and
includes a column named `dist_to_tss` that indicates the distance
between the TSS position and the PAM site of the gRNA. For CRISPRi, we
recommend targeting the 25-75bp region downstream of the TSS for optimal
inhibition. For CRISPRa, we recommend targeting the region 75-150bp
upstream of the TSS for optimal activation; see (Sanson et al. 2018) for
more information.

For more information, please see the following two tutorials:

- [CRISPR activation (CRISPRa)
  design](https://github.com/crisprVerse/Tutorials/tree/master/Design_CRISPRa)
- [CRISPR interference (CRISPRi)
  design](https://github.com/crisprVerse/Tutorials/tree/master/Design_CRISPRi)

# CRISPR base editing with BE4max

We illustrate the CRISPR base editing (CRISPRbe) functionalities of
`crisprDesign` by designing and characterizing gRNAs targeting IQSEC3
using the cytidine base editor BE4max (Koblan et al. 2018).

We first load the BE4max `BaseEditor` object available in `crisprBase`:

``` r
data(BE4max, package="crisprBase")
BE4max
```

## Class: BaseEditor
    ##   CRISPR Nuclease name: SpCas9
    ##       Target type: DNA
    ##       Metadata: list of length 2
    ##       PAMs: NGG, NAG, NGA
    ##       Weights: 1, 0.2593, 0.0694
    ##       Spacer length: 20
    ##       PAM side: 3prime
    ##         Distance from PAM: 0
    ##       Prototype protospacers: 5'--SSSSSSSSSSSSSSSSSSSS[NGG]--3', 5'--SSSSSSSSSSSSSSSSSSSS[NAG]--3', 5'--SSSSSSSSSSSSSSSSSSSS[NGA]--3'
    ##   Base editor name: BE4max
    ##       Editing strand: original
    ##       Maximum editing weight: C2T at position -15

The editing probabilities of the base editor BE4max are stored in a
matrix where rows correspond to the different nucleotide substitutions,
and columns correspond to the genomic coordinate relative to the PAM
site. The `editingWeights` function from `crisprBase` allows to retrieve
those probabilities. One can see that C to T editing is optimal around
15 nucleotides upstream of the PAM site for the BE4max base editor:

``` r
crisprBase::editingWeights(BE4max)["C2T",]
```

##   -36   -35   -34   -33   -32   -31   -30   -29   -28   -27   -26   -25   -24 
    ## 0.007 0.007 0.008 0.018 0.010 0.020 0.014 0.012 0.023 0.013 0.024 0.022 0.034 
    ##   -23   -22   -21   -20   -19   -18   -17   -16   -15   -14   -13   -12   -11 
    ## 0.022 0.021 0.035 0.058 0.162 0.318 0.632 0.903 1.000 0.870 0.620 0.314 0.163 
    ##   -10    -9    -8    -7    -6    -5    -4    -3    -2    -1 
    ## 0.100 0.056 0.033 0.019 0.018 0.024 0.017 0.005 0.002 0.001

We obtain a `GuideSet` object using the first exon of the IQSEC3 gene
and retain only the first 2 gRNAs for the sake of time:

``` r
gr <- queryTxObject(txObject=grListExample,
                    featureType="cds",
                    queryColumn="gene_symbol",
                    queryValue="IQSEC3")
gs <- findSpacers(gr[1],
                  bsgenome=bsgenome,
                  crisprNuclease=BE4max)
gs <- gs[1:2]
```

The function `addEditedAlleles` finds, characterizes, and scores
predicted edited alleles for each gRNA, for a chosen transcript. It
requires a transcript-specific annotation that can be obtained using the
function `getTxInfoDataFrame`. Here, we will perform the analysis using
the main isoform of IQSEC3 (transcript id ENST00000538872).

We first get the transcript table for ENST00000538872,

``` r
txid <- "ENST00000538872"
txTable <- getTxInfoDataFrame(tx_id=txid,
                              txObject=grListExample,
                              bsgenome=bsgenome)
head(txTable)
```

## DataFrame with 6 rows and 10 columns
    ##           chr       pos         nuc          aa aa_number      exon  pos_plot
    ##   <character> <numeric> <character> <character> <integer> <integer> <integer>
    ## 1       chr12     66767           A          NA        NA         1        31
    ## 2       chr12     66768           G          NA        NA         1        32
    ## 3       chr12     66769           G          NA        NA         1        33
    ## 4       chr12     66770           C          NA        NA         1        34
    ## 5       chr12     66771           T          NA        NA         1        35
    ## 6       chr12     66772           G          NA        NA         1        36
    ##    pos_mrna   pos_cds      region
    ##   <integer> <integer> <character>
    ## 1         1        NA        5UTR
    ## 2         2        NA        5UTR
    ## 3         3        NA        5UTR
    ## 4         4        NA        5UTR
    ## 5         5        NA        5UTR
    ## 6         6        NA        5UTR

and then add the edited alleles annotation to the `GuideSet`:

``` r
editingWindow <- c(-20,-8)
gs <- addEditedAlleles(gs,
                       baseEditor=BE4max,
                       txTable=txTable,
                       editingWindow=editingWindow)
```

## [addEditedAlleles] Obtaining edited alleles at each gRNA target site.

## [addEditedAlleles] Adding functional consequences to alleles.

The `editingWindow` argument specifies the window of editing that we are
interested in. When not provided, it uses the default window provided in
the `BaseEditor` object. Note that providing large windows can
exponentially increase computing time as the number of possible alleles
grows exponentially.Let’s retrieve the edited alleles for the first
gRNA:

``` r
alleles <- editedAlleles(gs)[[1]]
```

It is a `DataFrame` object that contains useful metadata information:

``` r
metadata(alleles)
```

## $wildtypeAllele
    ##        spacer_1 
    ## "CGCGCACCGGATT" 
    ## 
    ## $start
    ## [1] 66901
    ## 
    ## $end
    ## [1] 66913
    ## 
    ## $chr
    ## [1] "chr12"
    ## 
    ## $strand
    ## [1] "-"
    ## 
    ## $editingWindow
    ## [1] -20  -8
    ## 
    ## $wildtypeAmino
    ## [1] "NNNPPPVVVRRRA"

The `wildtypeAllele` reports the unedited nucleotide sequence of the
region specified by the editing window (with respect to the gRNA PAM
site). It is always reported from the 5’ to 3’ direction on the strand
corresponding to the gRNA strand. The `start` and `end` specify the
corresponding coordinates on the transcript.

Let’s look at the edited alleles:

``` r
head(alleles)
```

## DataFrame with 6 rows and 4 columns
    ##              seq     score     variant            aa
    ##   <DNAStringSet> <numeric> <character>   <character>
    ## 1  CGCGTATTGGATT 0.2471509    missense NNNPPPIIIRRRA
    ## 2  CGCGTATCGGATT 0.1618439    missense NNNPPPIIIRRRA
    ## 3  CGTGTATTGGATT 0.1057792    missense NNNPPPIIIHHHA
    ## 4  CGTGTATCGGATT 0.0692683    missense NNNPPPIIIHHHA
    ## 5  CGCGTACTGGATT 0.0372147      silent NNNPPPVVVRRRA
    ## 6  CGCGCATTGGATT 0.0292859    missense NNNPPPMMMRRRA

The `DataFrame` is ordered so that the top predicted alleles (based on
the `score` column) are shown first. The `score` represents the
likelihood of the edited allele to occur relative to all possible edited
alleles, and is calculated using the editing weights stored in the
`BE4max` object. The `seq` column represents the edited nucleotide
sequences. Similar to the `wildtypeAllele` above, they are always
reported from the 5’ to 3’ direction on the strand corresponding to the
gRNA strand. The `variant` column indicates the functional consequence
of the editing event (silent, nonsense or missense mutation). In case an
edited allele leads to multiple editing events, the most detrimental
mutation (nonsense over missense, missense over silent) is reported. The
`aa` column reports the result edited amino acid sequence.

Note that several gRNA-level aggregate scores have also been added to
the `GuideSet` object when calling `addEditedAlleles`:

``` r
head(gs)
```

## GuideSet object with 2 ranges and 11 metadata columns:
    ##            seqnames    ranges strand |          protospacer            pam
    ##               <Rle> <IRanges>  <Rle> |       <DNAStringSet> <DNAStringSet>
    ##   spacer_1    chr12     66893      - | CGCGCACCGGATTCTCCAGC            AGG
    ##   spacer_2    chr12     66896      + | GGGCGGCATGGAGAGCCTGC            TGG
    ##             pam_site  cut_site      region
    ##            <numeric> <numeric> <character>
    ##   spacer_1     66893     66896    region_1
    ##   spacer_2     66896     66893    region_1
    ##                                                                                                              editedAlleles
    ##                                                                                                                     <list>
    ##   spacer_1 CGCGTATTGGATT:0.247151:missense:...,CGCGTATCGGATT:0.161844:missense:...,CGTGTATTGGATT:0.105779:missense:...,...
    ##   spacer_2    GGGTGGTATGGAG:0.4644396:silent:...,GGGCGGTATGGAG:0.2976235:silent:...,GGGTGGCATGGAG:0.0699329:silent:...,...
    ##            score_missense score_nonsense score_silent  maxVariant
    ##                 <numeric>      <numeric>    <numeric> <character>
    ##   spacer_1      0.9020188              0    0.0745221    missense
    ##   spacer_2      0.0036734              0    0.9514897      silent
    ##            maxVariantScore
    ##                  <numeric>
    ##   spacer_1        0.902019
    ##   spacer_2        0.951490
    ##   -------
    ##   seqinfo: 640 sequences (1 circular) from hg38 genome
    ##   crisprNuclease: SpCas9

The `score_missense`, `score_nonsense` and `score_silent` columns
represent aggregated scores for each of the mutation type. They were
obtained by summing adding up all scores for a given mutation type
across the set of edited alleles for a given gRNA. The `maxVariant`
column indicates the most likely to occur mutation type for a given
gRNA, and is based on the maximum aggregated score, which is stored in
`maxVariantScore`. For instance, for spacer_1, the higher score is the
`score_missense`, and therefore `maxVariant` is set to missense.

For more information, please see the following tutorial:

- [CRISPR base editing (CRISPRbe)
  design](https://github.com/crisprVerse/Tutorials/tree/master/Design_CRISPRbe)

# CRISPR knockdown with Cas13d

It is also possible to design gRNAs for RNA-targeting nucleases using
`crisprDesign`. In contrast to DNA-targeting nucleases, the target
spacer is composed of mRNA sequences instead of DNA genomic sequences.

We illustrate the functionalities of `crisprDesign` for RNA-targeting
nucleases by designing gRNAs targeting IQSEC3 using the CasRx
(RfxCas13d) nuclease (Konermann et al. 2018).

We first load the CasRx `CrisprNuclease` object from `crisprBase`:

``` r
data(CasRx, package="crisprBase")
CasRx
```

## Class: CrisprNuclease
    ##   Name: CasRx
    ##   Target type: RNA
    ##   Metadata: list of length 2
    ##   PFS: N
    ##   Weights: 1
    ##   Spacer length: 23
    ##   PFS side: 3prime
    ##     Distance from PFS: 0
    ##   Prototype protospacers: 5'--SSSSSSSSSSSSSSSSSSSSSSS[N]--3'

The PFS sequence (the equivalent of a PAM sequence for RNA-targeting
nucleases) for CasRx is `N`, meaning that there is no specific PFS
sequences preferred by CasRx.

We will now design CasRx gRNAs for the transcript ENST00000538872 of
IQSEC3.

Let’s first extract all mRNA sequences for IQSEC3:

``` r
txid <- c("ENST00000538872","ENST00000382841")
mrnas <- getMrnaSequences(txid=txid,
                          bsgenome=bsgenome,
                          txObject=grListExample)
mrnas
```

## DNAStringSet object of length 2:
    ##     width seq                                               names               
    ## [1]  2701 AAGCCCCTCCCCTTCTCTGGGCC...AAAGTTACTGCTAGCATGGGTAA ENST00000382841
    ## [2]  7087 AGGCTGGGCCGGTGGGAGAGGGA...TTATATTGAAAGATGTCACTTGA ENST00000538872

We can use the usual function `findSpacers` to design gRNAs, and we only
consider a random subset of 100 gRNAs for the sake of time:

``` r
gs <- findSpacers(mrnas[["ENST00000538872"]],
                  crisprNuclease=CasRx)
gs <- gs[1000:1100]
head(gs)
```

## GuideSet object with 6 ranges and 5 metadata columns:
    ##               seqnames    ranges strand |             protospacer
    ##                  <Rle> <IRanges>  <Rle> |          <DNAStringSet>
    ##   spacer_1000 region_1      1023      + | TTGACCTAAAGAATAAACAGATT
    ##   spacer_1001 region_1      1024      + | TGACCTAAAGAATAAACAGATTG
    ##   spacer_1002 region_1      1025      + | GACCTAAAGAATAAACAGATTGA
    ##   spacer_1003 region_1      1026      + | ACCTAAAGAATAAACAGATTGAA
    ##   spacer_1004 region_1      1027      + | CCTAAAGAATAAACAGATTGAAA
    ##   spacer_1005 region_1      1028      + | CTAAAGAATAAACAGATTGAAAT
    ##                          pam  pam_site  cut_site      region
    ##               <DNAStringSet> <numeric> <numeric> <character>
    ##   spacer_1000              G      1023        NA    region_1
    ##   spacer_1001              A      1024        NA    region_1
    ##   spacer_1002              A      1025        NA    region_1
    ##   spacer_1003              A      1026        NA    region_1
    ##   spacer_1004              T      1027        NA    region_1
    ##   spacer_1005              G      1028        NA    region_1
    ##   -------
    ##   seqinfo: 1 sequence from custom genome
    ##   crisprNuclease: CasRx

Note that all protospacer sequences are located on the original strand
of the mRNA sequence. For RNA-targeting nucleases, the spacer and
protospacer sequences are the reverse complement of each other:

``` r
head(spacers(gs))
```

## DNAStringSet object of length 6:
    ##     width seq                                               names               
    ## [1]    23 AATCTGTTTATTCTTTAGGTCAA                           spacer_1000
    ## [2]    23 CAATCTGTTTATTCTTTAGGTCA                           spacer_1001
    ## [3]    23 TCAATCTGTTTATTCTTTAGGTC                           spacer_1002
    ## [4]    23 TTCAATCTGTTTATTCTTTAGGT                           spacer_1003
    ## [5]    23 TTTCAATCTGTTTATTCTTTAGG                           spacer_1004
    ## [6]    23 ATTTCAATCTGTTTATTCTTTAG                           spacer_1005

``` r
head(protospacers(gs))
```

## DNAStringSet object of length 6:
    ##     width seq                                               names               
    ## [1]    23 TTGACCTAAAGAATAAACAGATT                           spacer_1000
    ## [2]    23 TGACCTAAAGAATAAACAGATTG                           spacer_1001
    ## [3]    23 GACCTAAAGAATAAACAGATTGA                           spacer_1002
    ## [4]    23 ACCTAAAGAATAAACAGATTGAA                           spacer_1003
    ## [5]    23 CCTAAAGAATAAACAGATTGAAA                           spacer_1004
    ## [6]    23 CTAAAGAATAAACAGATTGAAAT                           spacer_1005

The `addSpacerAlignments` can be used to perform an off-target search
across all mRNA sequences using the argument `custom_seq`. Here, for the
sake of time, we only perform an off-target search to the 2 isoforms of
IQSEC3 specified by the `mRNAs` object:

``` r
gs <- addSpacerAlignments(gs,
                          aligner="biostrings",
                          txObject=grListExample,
                          n_mismatches=1,
                          custom_seq=mrnas)
tail(gs)
```

## GuideSet object with 6 ranges and 10 metadata columns:
    ##               seqnames    ranges strand |             protospacer
    ##                  <Rle> <IRanges>  <Rle> |          <DNAStringSet>
    ##   spacer_1095 region_1      1118      + | CGCCAATACCAGCTCAGCAAGAA
    ##   spacer_1096 region_1      1119      + | GCCAATACCAGCTCAGCAAGAAC
    ##   spacer_1097 region_1      1120      + | CCAATACCAGCTCAGCAAGAACT
    ##   spacer_1098 region_1      1121      + | CAATACCAGCTCAGCAAGAACTT
    ##   spacer_1099 region_1      1122      + | AATACCAGCTCAGCAAGAACTTC
    ##   spacer_1100 region_1      1123      + | ATACCAGCTCAGCAAGAACTTCG
    ##                          pam  pam_site  cut_site      region     n0_tx
    ##               <DNAStringSet> <numeric> <numeric> <character> <numeric>
    ##   spacer_1095              C      1118        NA    region_1         2
    ##   spacer_1096              T      1119        NA    region_1         2
    ##   spacer_1097              T      1120        NA    region_1         2
    ##   spacer_1098              C      1121        NA    region_1         2
    ##   spacer_1099              G      1122        NA    region_1         2
    ##   spacer_1100              A      1123        NA    region_1         2
    ##                   n1_tx   n0_gene   n1_gene
    ##               <numeric> <numeric> <numeric>
    ##   spacer_1095         0         1         0
    ##   spacer_1096         0         1         0
    ##   spacer_1097         0         1         0
    ##   spacer_1098         0         1         0
    ##   spacer_1099         0         1         0
    ##   spacer_1100         0         1         0
    ##                                                 alignments
    ##                                              <GRangesList>
    ##   spacer_1095 ENST00000382841:505:+,ENST00000538872:1118:+
    ##   spacer_1096 ENST00000382841:506:+,ENST00000538872:1119:+
    ##   spacer_1097 ENST00000382841:507:+,ENST00000538872:1120:+
    ##   spacer_1098 ENST00000382841:508:+,ENST00000538872:1121:+
    ##   spacer_1099 ENST00000382841:509:+,ENST00000538872:1122:+
    ##   spacer_1100 ENST00000382841:510:+,ENST00000538872:1123:+
    ##   -------
    ##   seqinfo: 1 sequence from custom genome
    ##   crisprNuclease: CasRx

The columns `n0_gene` and `n0_tx` report the number of on-targets at the
gene- and transcript-level, respectively. For instance, `spacer_1095`
maps to the two isoforms of IQSEC3 has `n0_tx` is equal to 2:

``` r
onTargets(gs["spacer_1095"])
```

## GRanges object with 2 ranges and 9 metadata columns:
    ##                      seqnames    ranges strand |                 spacer
    ##                         <Rle> <IRanges>  <Rle> |            <character>
    ##   spacer_1095 ENST00000382841       505      + | TTCTTGCTGAGCTGGTATTG..
    ##   spacer_1095 ENST00000538872      1118      + | TTCTTGCTGAGCTGGTATTG..
    ##                           protospacer            pam  pam_site n_mismatches
    ##                        <DNAStringSet> <DNAStringSet> <numeric>    <numeric>
    ##   spacer_1095 CGCCAATACCAGCTCAGCAAGAA              C       505            0
    ##   spacer_1095 CGCCAATACCAGCTCAGCAAGAA              C      1118            0
    ##               canonical  cut_site         gene_id gene_symbol
    ##               <logical> <numeric>     <character> <character>
    ##   spacer_1095      TRUE        NA ENSG00000120645      IQSEC3
    ##   spacer_1095      TRUE        NA ENSG00000120645      IQSEC3
    ##   -------
    ##   seqinfo: 2 sequences from custom genome

Note that one can also use the `bowtie` aligner to perform an off-target
search to a set of mRNA sequences. This requires building a
transcriptome bowtie index first instead of building a genome index. See
the `crisprBowtie` vignette for more detail.

For more information, please see the following tutorial:

- [CRISPR knockdown (CRISPRkd) design with
  CasRxdesign](https://github.com/crisprVerse/Tutorials/tree/master/Design_CRISPRkd_CasRx)

# Design for optical pooled screening (OPS)

Optical pooled screening (OPS) combines image-based sequencing (in situ
sequencing) of gRNAs and optical phenotyping on the same physical wells
(Feldman et al. 2019). In such experiments, gRNA spacer sequences are
partially sequenced from the 5 prime end. From a gRNA design
perspective, additional gRNA design constraints are needed to ensure
sufficient dissimilarity of the truncated spacer sequences. The length
of the truncated sequences, which corresponds to the number of
sequencing cycles, is fixed and chosen by the experimentalist.

To illustrate the functionalities of `crisprDesign` for designing OPS
libraries, we use the `guideSetExample`. We will design an OPS library
with 8 cycles.

``` r
n_cycles=8
```

We add the 8nt OPS barcodes to the GuideSet using the `addOpsBarcodes`
function:

``` r
data(guideSetExample, package="crisprDesign")
guideSetExample <- addOpsBarcodes(guideSetExample,
                                  n_cycles=n_cycles)
head(guideSetExample$opsBarcode)
```

## DNAStringSet object of length 6:
    ##     width seq                                               names               
    ## [1]     8 CGCGCACC                                          spacer_1
    ## [2]     8 GGGCGGCA                                          spacer_2
    ## [3]     8 GGAGAGCC                                          spacer_3
    ## [4]     8 AGGTAGAG                                          spacer_4
    ## [5]     8 GAGCTCCT                                          spacer_5
    ## [6]     8 CGATGGCC                                          spacer_6

The function `getBarcodeDistanceMatrix` calculates the nucleotide
distance between a set of query barcodes and a set of target barcodes.
The type of distance (hamming or levenshtein) can be specified using the
`dist_method` argument. The Hamming distance (default) only considers
substitutions when calculating distances, while the Levenshtein distance
allows insertions and deletions.

When the argument `binnarize` is set to `FALSE`, the return object is a
matrix of pairwise distances between query and target barcodes:

``` r
barcodes <- guideSetExample$opsBarcode
dist <- getBarcodeDistanceMatrix(barcodes[1:5],
                                 barcodes[6:10],
                                 binnarize=FALSE)
print(dist)
```

## 5 x 5 sparse Matrix of class "dgCMatrix"
    ##          CGATGGCC GCGCGCCG GCTCTACC GCTCTGCT GGGTGTGG
    ## CGCGCACC        4        7        5        7        7
    ## GGGCGGCA        4        3        5        4        4
    ## GGAGAGCC        3        6        5        5        6
    ## AGGTAGAG        5        6        8        7        4
    ## GAGCTCCT        7        3        4        3        6

When `binnarize` is set to `TRUE` (default), the matrix of distances is
binnarized so that 1 indicates similar barcodes, and 0 indicates
dissimilar barcodes. The `min_dist_edit` argument specifies the minimal
distance between two barcodes to be considered dissimilar:

``` r
dist <- getBarcodeDistanceMatrix(barcodes[1:5],
                                 barcodes[6:10],
                                 binnarize=TRUE,
                                 min_dist_edit=4)
print(dist)
```

## 5 x 5 sparse Matrix of class "dtCMatrix"
    ##          CGATGGCC GCGCGCCG GCTCTACC GCTCTGCT GGGTGTGG
    ## CGCGCACC        .        .        .        .        .
    ## GGGCGGCA        .        1        .        .        .
    ## GGAGAGCC        1        .        .        .        .
    ## AGGTAGAG        .        .        .        .        .
    ## GAGCTCCT        .        1        .        1        .

The `designOpsLibrary` allows users to perform a complete end-to-end
library design; see `?designOpsLibrary` for documentation.

For more information, please see the following tutorial:

- [Design for
  OPS](https://github.com/crisprVerse/Tutorials/tree/master/Design_OPS)

# Design of gRNA pairs with the  object

The `findSpacerPairs` function in `crisprDesign` enables the design of
pairs of gRNAs and works similar to `findSpacers`. As an example, we
will design candidate pairs of gRNAs that target a small locus located
on chr12 in the human genome:

``` r
library(GenomicRanges)
library(BSgenome.Hsapiens.UCSC.hg38)
library(crisprBase)
bsgenome <- BSgenome.Hsapiens.UCSC.hg38
```

We first specify the genomic locus:

``` r
gr <- GRanges(c("chr12"),
              IRanges(start=22224014, end=22225007))
```

and find all pairs using the function `findSpacerPairs`:

``` r
pairs <- findSpacerPairs(gr, gr, bsgenome=bsgenome)
```

The first and second arguments of the function specify the which genomic
region the first and second gRNA should target, respectively. In our
case, we are targeting the same region with both gRNAs. The other
arguments of the function are similar to the `findSpacers` function
described below.

The output object is a `PairedGuideSet`, which can be thought of a list
of two `GuideSet`:

``` r
pairs
```

## PairedGuideSet object with 2626 pairs and 4 metadata columns:
    ##                     first           second | pamOrientation pamDistance
    ##                <GuideSet>       <GuideSet> |    <character>   <numeric>
    ##      [1] chr12:22224025:- chr12:22224033:+ |            out           8
    ##      [2] chr12:22224025:- chr12:22224055:- |            rev          30
    ##      [3] chr12:22224033:+ chr12:22224055:- |             in          22
    ##      [4] chr12:22224025:- chr12:22224056:- |            rev          31
    ##      [5] chr12:22224033:+ chr12:22224056:- |             in          23
    ##      ...              ...              ... .            ...         ...
    ##   [2622] chr12:22224937:- chr12:22224994:+ |            out          57
    ##   [2623] chr12:22224938:- chr12:22224994:+ |            out          56
    ##   [2624] chr12:22224944:- chr12:22224994:+ |            out          50
    ##   [2625] chr12:22224950:+ chr12:22224994:+ |            fwd          44
    ##   [2626] chr12:22224958:- chr12:22224994:+ |            out          36
    ##          spacerDistance cutLength
    ##               <integer> <numeric>
    ##      [1]            -32         2
    ##      [2]             11        30
    ##      [3]             24        28
    ##      [4]             12        31
    ##      [5]             25        29
    ##      ...            ...       ...
    ##   [2622]             17        51
    ##   [2623]             16        50
    ##   [2624]             10        44
    ##   [2625]             25        44
    ##   [2626]             -4        30

The first and second `GuideSet` store information about gRNAs at
position 1 and position 2, respectively. They can be accessed using the
`first` and `second` functions:

``` r
grnas1 <- first(pairs)
grnas2 <- second(pairs)
grnas1
```

## GuideSet object with 2626 ranges and 5 metadata columns:
    ##             seqnames    ranges strand |          protospacer            pam
    ##                <Rle> <IRanges>  <Rle> |       <DNAStringSet> <DNAStringSet>
    ##    spacer_1    chr12  22224025      - | ATTAGTACAACCTTTCTTTT            AGG
    ##    spacer_1    chr12  22224025      - | ATTAGTACAACCTTTCTTTT            AGG
    ##    spacer_2    chr12  22224033      + | CTTTTGTTTTCCTAAAAGAA            AGG
    ##    spacer_1    chr12  22224025      - | ATTAGTACAACCTTTCTTTT            AGG
    ##    spacer_2    chr12  22224033      + | CTTTTGTTTTCCTAAAAGAA            AGG
    ##         ...      ...       ...    ... .                  ...            ...
    ##   spacer_68    chr12  22224937      - | GGCTGCCAGTCATTGGATCA            GGG
    ##   spacer_69    chr12  22224938      - | AGGCTGCCAGTCATTGGATC            AGG
    ##   spacer_70    chr12  22224944      - | TTTATAAGGCTGCCAGTCAT            TGG
    ##   spacer_71    chr12  22224950      + | GTGAGCCCTGATCCAATGAC            TGG
    ##   spacer_72    chr12  22224958      - | CACTGTTTTTTCTTTTTATA            AGG
    ##              pam_site  cut_site      region
    ##             <numeric> <numeric> <character>
    ##    spacer_1  22224025  22224028    region_1
    ##    spacer_1  22224025  22224028    region_1
    ##    spacer_2  22224033  22224030    region_1
    ##    spacer_1  22224025  22224028    region_1
    ##    spacer_2  22224033  22224030    region_1
    ##         ...       ...       ...         ...
    ##   spacer_68  22224937  22224940    region_1
    ##   spacer_69  22224938  22224941    region_1
    ##   spacer_70  22224944  22224947    region_1
    ##   spacer_71  22224950  22224947    region_1
    ##   spacer_72  22224958  22224961    region_1
    ##   -------
    ##   seqinfo: 640 sequences (1 circular) from hg38 genome
    ##   crisprNuclease: SpCas9

``` r
grnas2
```

## GuideSet object with 2626 ranges and 5 metadata columns:
    ##             seqnames    ranges strand |          protospacer            pam
    ##                <Rle> <IRanges>  <Rle> |       <DNAStringSet> <DNAStringSet>
    ##    spacer_2    chr12  22224033      + | CTTTTGTTTTCCTAAAAGAA            AGG
    ##    spacer_3    chr12  22224055      - | TATTCTCATGCACTGCTAGT            GGG
    ##    spacer_3    chr12  22224055      - | TATTCTCATGCACTGCTAGT            GGG
    ##    spacer_4    chr12  22224056      - | ATATTCTCATGCACTGCTAG            TGG
    ##    spacer_4    chr12  22224056      - | ATATTCTCATGCACTGCTAG            TGG
    ##         ...      ...       ...    ... .                  ...            ...
    ##   spacer_73    chr12  22224994      + | CAGTGACATAGATCATACAT            AGG
    ##   spacer_73    chr12  22224994      + | CAGTGACATAGATCATACAT            AGG
    ##   spacer_73    chr12  22224994      + | CAGTGACATAGATCATACAT            AGG
    ##   spacer_73    chr12  22224994      + | CAGTGACATAGATCATACAT            AGG
    ##   spacer_73    chr12  22224994      + | CAGTGACATAGATCATACAT            AGG
    ##              pam_site  cut_site      region
    ##             <numeric> <numeric> <character>
    ##    spacer_2  22224033  22224030    region_1
    ##    spacer_3  22224055  22224058    region_1
    ##    spacer_3  22224055  22224058    region_1
    ##    spacer_4  22224056  22224059    region_1
    ##    spacer_4  22224056  22224059    region_1
    ##         ...       ...       ...         ...
    ##   spacer_73  22224994  22224991    region_1
    ##   spacer_73  22224994  22224991    region_1
    ##   spacer_73  22224994  22224991    region_1
    ##   spacer_73  22224994  22224991    region_1
    ##   spacer_73  22224994  22224991    region_1
    ##   -------
    ##   seqinfo: 640 sequences (1 circular) from hg38 genome
    ##   crisprNuclease: SpCas9

The `pamOrientation` function returns the PAM orientation of the pairs:

``` r
head(pamOrientation(pairs))
```

## [1] "out" "rev" "in"  "rev" "in"  "rev"

and takes 4 different values: `in` (for PAM-in configuration) `out` (for
PAM-out configuration), `fwd` (both gRNAs target the forward strand) and
`rev` (both gRNAs target the reverse strand).

The function `pamDistance` returns the distance between the PAM sites of
the two gRNAs. The function `cutLength` returns the distance between the
cut sites of the two gRNAs. The function `spacerDistance` returns the
distance between the two spacer sequences of the gRNAs.

For more information, please see the following tutorial:

- [Paired gRNA
  design](https://github.com/crisprVerse/Tutorials/tree/master/Design_PairedGuides)

# Miscellaneous design use cases

## Design with custom sequences

`crisprDesign` also allows gRNA design for DNA sequences without genomic
context (such as a synthesized DNA construct). See `?findSpacers` for
more information, and here’s an example:

``` r
seqs <- c(seq1="AGGCGGAGGCCCGACCCGGGCGCGGGGCGGCGC",
          seq2="AGGCGGAGGCCCGACCCGGGCGCGGGAAAAAAAGGC")
gs <- findSpacers(seqs)
head(gs)
```

## GuideSet object with 6 ranges and 5 metadata columns:
    ##            seqnames    ranges strand |          protospacer            pam
    ##               <Rle> <IRanges>  <Rle> |       <DNAStringSet> <DNAStringSet>
    ##   spacer_1     seq1        12      - | CGCCGCCCCGCGCCCGGGTC            GGG
    ##   spacer_2     seq1        13      - | GCGCCGCCCCGCGCCCGGGT            CGG
    ##   spacer_3     seq1        23      + | GCGGAGGCCCGACCCGGGCG            CGG
    ##   spacer_4     seq1        24      + | CGGAGGCCCGACCCGGGCGC            GGG
    ##   spacer_5     seq1        25      + | GGAGGCCCGACCCGGGCGCG            GGG
    ##   spacer_6     seq1        28      + | GGCCCGACCCGGGCGCGGGG            CGG
    ##             pam_site  cut_site      region
    ##            <numeric> <numeric> <character>
    ##   spacer_1        12        15        seq1
    ##   spacer_2        13        16        seq1
    ##   spacer_3        23        20        seq1
    ##   spacer_4        24        21        seq1
    ##   spacer_5        25        22        seq1
    ##   spacer_6        28        25        seq1
    ##   -------
    ##   seqinfo: 2 sequences from custom genome
    ##   crisprNuclease: SpCas9

## Off-target search in custom sequences

One can also search for off-targets in a custom sequence as follows:

``` r
ontarget <- "AAGACCCGGGCGCGGGGCGGGGG"
offtarget <- "TTGACCCGGGCGCGGGGCGGGGG"
gs <- findSpacers(ontarget)
gs <- addSpacerAlignments(gs,
                          aligner="biostrings",
                          n_mismatches=2,
                          custom_seq=offtarget)
head(alignments(gs))
```

## GRanges object with 1 range and 7 metadata columns:
    ##               seqnames    ranges strand |               spacer
    ##                  <Rle> <IRanges>  <Rle> |       <DNAStringSet>
    ##   spacer_1 custom_seq1        21      + | AAGACCCGGGCGCGGGGCGG
    ##                     protospacer            pam  pam_site n_mismatches canonical
    ##                  <DNAStringSet> <DNAStringSet> <numeric>    <numeric> <logical>
    ##   spacer_1 TTGACCCGGGCGCGGGGCGG            GGG        21            2      TRUE
    ##             cut_site
    ##            <numeric>
    ##   spacer_1        18
    ##   -------
    ##   seqinfo: 1 sequence from custom genome

For more information, please see the following tutorial:

- [Working with custom DNA
  sequences](https://github.com/crisprVerse/Tutorials/tree/master/Design_Custom_Sequence)

# Session Info

``` r
sessionInfo()
```

## R version 4.2.2 (2022-10-31)
    ## Platform: x86_64-apple-darwin17.0 (64-bit)
    ## Running under: macOS Catalina 10.15.7
    ## 
    ## Matrix products: default
    ## BLAS:   /Library/Frameworks/R.framework/Versions/4.2/Resources/lib/libRblas.0.dylib
    ## LAPACK: /Library/Frameworks/R.framework/Versions/4.2/Resources/lib/libRlapack.dylib
    ## 
    ## locale:
    ## [1] en_US.UTF-8/en_US.UTF-8/en_US.UTF-8/C/en_US.UTF-8/en_US.UTF-8
    ## 
    ## attached base packages:
    ## [1] stats4    stats     graphics  grDevices utils     datasets  methods  
    ## [8] base     
    ## 
    ## other attached packages:
    ##  [1] Rbowtie_1.36.0                    BSgenome.Hsapiens.UCSC.hg38_1.4.4
    ##  [3] BSgenome_1.64.0                   rtracklayer_1.56.1               
    ##  [5] Biostrings_2.64.0                 XVector_0.36.0                   
    ##  [7] GenomicRanges_1.48.0              GenomeInfoDb_1.32.3              
    ##  [9] IRanges_2.30.0                    S4Vectors_0.34.0                 
    ## [11] BiocGenerics_0.42.0               crisprDesign_1.1.0               
    ## [13] crisprBase_1.3.0                 
    ## 
    ## loaded via a namespace (and not attached):
    ##   [1] bitops_1.0-7                  matrixStats_0.62.0           
    ##   [3] bit64_4.0.5                   filelock_1.0.2               
    ##   [5] progress_1.2.2                httr_1.4.4                   
    ##   [7] tools_4.2.2                   utf8_1.2.2                   
    ##   [9] R6_2.5.1                      DBI_1.1.3                    
    ##  [11] tidyselect_1.1.2              prettyunits_1.1.1            
    ##  [13] bit_4.0.4                     curl_4.3.2                   
    ##  [15] compiler_4.2.2                crisprBowtie_1.1.1           
    ##  [17] cli_3.3.0                     Biobase_2.56.0               
    ##  [19] basilisk.utils_1.9.1          crisprScoreData_1.1.3        
    ##  [21] xml2_1.3.3                    DelayedArray_0.22.0          
    ##  [23] randomForest_4.7-1.1          readr_2.1.2                  
    ##  [25] rappdirs_0.3.3                stringr_1.4.0                
    ##  [27] digest_0.6.29                 Rsamtools_2.12.0             
    ##  [29] rmarkdown_2.15                crisprScore_1.1.14           
    ##  [31] basilisk_1.9.2                pkgconfig_2.0.3              
    ##  [33] htmltools_0.5.3               MatrixGenerics_1.8.1         
    ##  [35] dbplyr_2.2.1                  fastmap_1.1.0                
    ##  [37] rlang_1.0.4                   rstudioapi_0.13              
    ##  [39] RSQLite_2.2.16                shiny_1.7.2                  
    ##  [41] BiocIO_1.6.0                  generics_0.1.3               
    ##  [43] jsonlite_1.8.0                vroom_1.5.7                  
    ##  [45] BiocParallel_1.30.3           dplyr_1.0.9                  
    ##  [47] VariantAnnotation_1.42.1      RCurl_1.98-1.8               
    ##  [49] magrittr_2.0.3                GenomeInfoDbData_1.2.8       
    ##  [51] Matrix_1.5-1                  Rcpp_1.0.9                   
    ##  [53] fansi_1.0.3                   reticulate_1.25              
    ##  [55] lifecycle_1.0.1               stringi_1.7.8                
    ##  [57] yaml_2.3.5                    SummarizedExperiment_1.26.1  
    ##  [59] zlibbioc_1.42.0               BiocFileCache_2.4.0          
    ##  [61] AnnotationHub_3.4.0           grid_4.2.2                   
    ##  [63] blob_1.2.3                    promises_1.2.0.1             
    ##  [65] parallel_4.2.2                ExperimentHub_2.4.0          
    ##  [67] crayon_1.5.1                  crisprBwa_1.1.3              
    ##  [69] dir.expiry_1.4.0              lattice_0.20-45              
    ##  [71] GenomicFeatures_1.48.3        hms_1.1.1                    
    ##  [73] KEGGREST_1.36.3               knitr_1.39                   
    ##  [75] pillar_1.8.0                  rjson_0.2.21                 
    ##  [77] codetools_0.2-18              biomaRt_2.52.0               
    ##  [79] BiocVersion_3.15.2            XML_3.99-0.10                
    ##  [81] glue_1.6.2                    evaluate_0.16                
    ##  [83] BiocManager_1.30.18           httpuv_1.6.5                 
    ##  [85] png_0.1-7                     vctrs_0.4.1                  
    ##  [87] tzdb_0.3.0                    purrr_0.3.4                  
    ##  [89] assertthat_0.2.1              cachem_1.0.6                 
    ##  [91] xfun_0.32                     mime_0.12                    
    ##  [93] Rbwa_1.0.0                    xtable_1.8-4                 
    ##  [95] restfulr_0.0.15               later_1.3.0                  
    ##  [97] tibble_3.1.8                  GenomicAlignments_1.32.1     
    ##  [99] AnnotationDbi_1.58.0          memoise_2.0.1                
    ## [101] interactiveDisplayBase_1.34.0 ellipsis_0.3.2

# References

Feldman, David, Avtar Singh, Jonathan L Schmid-Burgk, Rebecca J Carlson,
Anja Mezger, Anthony J Garrity, Feng Zhang, and Paul C Blainey. 2019.
“Optical Pooled Screens in Human Cells.” *Cell* 179 (3): 787–99.

</div>

Gilbert, Luke A, Matthew H Larson, Leonardo Morsut, Zairan Liu, Gloria A
Brar, Sandra E Torres, Noam Stern-Ginossar, et al. 2013.
“CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in
Eukaryotes.” *Cell* 154 (2): 442–51.

</div>

Kampmann, Martin. 2018. “CRISPRi and CRISPRa Screens in Mammalian Cells
for Precision Biology and Medicine.” *ACS Chemical Biology* 13 (2):
406–16.

</div>

Koblan, Luke W, Jordan L Doman, Christopher Wilson, Jonathan M Levy,
Tristan Tay, Gregory A Newby, Juan Pablo Maianti, Aditya Raguram, and
David R Liu. 2018. “Improving Cytidine and Adenine Base Editors by
Expression Optimization and Ancestral Reconstruction.” *Nature
Biotechnology* 36 (9): 843–46.

</div>

Konermann, Silvana, Peter Lotfy, Nicholas J Brideau, Jennifer Oki, Maxim
N Shokhirev, and Patrick D Hsu. 2018. “Transcriptome Engineering with
RNA-Targeting Type VI-d CRISPR Effectors.” *Cell* 173 (3): 665–76.

</div>

Langmead, Ben, Cole Trapnell, Mihai Pop, and Steven L. Salzberg. 2009.
“Ultrafast and Memory-Efficient Alignment of Short DNA Sequences to the
Human Genome.” *Genome Biology* 10 (3): R25.
<https://doi.org/10.1186/gb-2009-10-3-r25>.

</div>

Sanson, Kendall R, Ruth E Hanna, Mudra Hegde, Katherine F Donovan,
Christine Strand, Meagan E Sullender, Emma W Vaimberg, et al. 2018.
“Optimized Libraries for CRISPR-Cas9 Genetic Screens with Multiple
Modalities.” *Nature Communications* 9 (1): 1–15.

</div>

crisprDesign

Explore Similar Repositories

Was this content helpful?

Recent Feedback

Download README