KO
|
EN
gitlite — search
Search
#javascript
#python
#hacktoberfest
#react
#ai
#typescript
#llm
#go
#golang
#android
#machine-learning
#rust
#deep-learning
#linux
miteFinder
★ 13
Open GitHub ↗
No description available.
Download README (.md)
Explore Similar Repositories
thumb
:
Time and Attendance App for ERPNext
LYJSwiftDemo
:
平时开发写的一些小控件 swift版本
robopon
:
Robot Poncots (ロボポン) Sun and Star (Japanese)
terraform-vpc
:
Modular Terraform repository to provision a multi-tier VPC in AWS
mqttfx-payload-decoders
:
The default preset of MQTT.fx message payload decoder implementations based on addon-commons.
// repository documentation
Was this content helpful?
★ 0
(0 ratings)
Select Rating:
★
★
★
★
★
Submit Feedback
Recent Feedback
×
Download README
Do you want to download the
README.md
file for
miteFinder
?
Download (.md)
# miteFinder ################################################################################ AUTHOR: JIALU HU EMAIL: jhu@nwpu.edu.cn Copyright (C) <2019> <Jialu Hu> This program is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with this program. If not, see <http://www.gnu.org/licenses/>. ################################################################################ # Description We have geneated binary code for Unix-like, Mac, and Windows users (see in $miteFinder/bin) Normally, it will works on machines with x86_64. If it doesn't work, you need to compile the source code for your own. ################################################################################ # Compile To compile the source code, the latest compilers which supports the standard language C++11, also known as C++0x, is needed. Other older compiler may not support it. Use the code as the following: cd $miteFinder make Then the binary code "miteFinder" will be generated and moved to $miteFinder/bin. Finished :) ################################################################################ # Example ./bin/miteFinder -input ${your_input_file} -output ${your_output_file} -pattern_scoring ./profile/pattern_scoring.txt -threshold 0.5 Warning: Your input file should be in sequences or genomes in fasta format. ################################################################################ # Result The description of the MITE is just like this： >mite|6|4131|4140|4194|4203|t3|4138|m1|ave_score:0.649614 GTTGCTCACCCCTGCTCTTGAGCCTTTGAAACATCTACACCAATTTTTTATTGTTTTCAT CTATCCGTTTAAGTGGATTAAAATGATGTTTTTTAATTTTTTTTTATATTTTTTGGGCCG AAAAAACGGACAGCATTGAAAAAAGCCAAGTTTTATTTAATTTAAGAAAAAATAGTCCAA CCAAATGGTTTAA The 6 means the serial number of chromosome and 4131,4140,4194,4203 is the position of TIR. t3 means the length of TSD is 3. m1 means the TIR is the imperfect inverted repeats and 4138 is the mismatch base. The ave_score:0.649614 is the score of MITE sequence(The more details can be seen in the below citation). ################################################################################ # Citation Hu J, Zheng Y, Shang X. MiteFinderII: a novel tool to identify miniature inverted-repeat transposable elements hidden in eukaryotic genomes. BMC medical genomics. 2018 Nov;11(5):51-9. https://doi.org/10.1186/s12920-018-0418-y ################################################################################ # END THANKS FOR READING If you have any questions regarding to the program, please don't hesitate to contact us through email.
