adapters

KO | EN

gitlite — search

#javascript #python #hacktoberfest #react #ai #typescript #llm #go #golang #android #machine-learning #rust #deep-learning #linux

(★ 30)

Adapters for trimming

adapters 최신버젼 다운로드

최종 버전 다운로드 (.zip)

// repository documentation

Was this content helpful?

★ 0 (0 ratings)

# Adapters for trimming

Source code for [trimmomatic](http://www.usadellab.org/cms/?page=trimmomatic) and [bbmap](https://sourceforge.net/projects/bbmap/) each contain fasta files with adapter files used for trimming. The [combine_adapters.R](combine_adapters.R) file in this directory will recursively search for any files ending in `.fa`. It will then combine them all, the look for unique sequences. If a single sequence has multiple entries within or between files, its sequence ID will be concatenated in a final combined fasta file. The final combined fasta file is written out with the number of unique sequences embedded in its filename.

For instance, the sequence `AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC` is represented in one file as `>PE2_rc` and in another file as `>TruSeq3_IndexedAdapter`. In the combined output file, it is represented once as `>PE2_rc | >TruSeq3_IndexedAdapter`.

The final combined fasta file for all adapters included here is: **[adapters_combined_152_unique.fasta](adapters_combined_152_unique.fasta)**.

Please see [CONTRIBUTING.md](CONTRIBUTING.md) if you wish to add to this repo.

adapters

adapters 최신버젼 다운로드

오늘의 추천 프로젝트

Was this content helpful?

Recent Feedback

adapters

adapters 최신버젼 다운로드

오늘의 추천 프로젝트

Was this content helpful?

Recent Feedback

Download README